BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 978a05 (302 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.33906 EST219231 Rattus norvegicus cDNA, 3' end /clone... 78 2e-14 gnl|UG|Rn.25100 EST192758 Rattus norvegicus cDNA, 3' end /clone... 62 1e-09 gnl|UG|Rn.7869 EST208415 Rattus norvegicus cDNA, 3' end /clone=... 62 1e-09 gnl|UG|Rn.33651 UI-R-BT0-qe-d-09-0-UI.s1 Rattus norvegicus cDNA... 60 4e-09 gnl|UG|Rn.21293 UI-R-Y0-lt-b-08-0-UI.s1 Rattus norvegicus cDNA,... 58 2e-08 >gnl|UG|Rn.33906 EST219231 Rattus norvegicus cDNA, 3' end /clone=ROVBD55 /clone_end=3' /gb=AI175671 /gi=3726309 /len=346 Length = 346 Score = 77.8 bits (39), Expect = 2e-14 Identities = 48/51 (94%), Positives = 48/51 (94%) Query: 249 ggtggcatatgcctttaatcccagcactcaggaggcagagccaagtggatc 299 ||||| |||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 73 ggtggtatatgcctttaatcccagcactcaggaggcagaggcaggtggatc 123 >gnl|UG|Rn.25100 EST192758 Rattus norvegicus cDNA, 3' end /clone=RMUAL48 /clone_end=3' /gb=AA849991 /gi=2937531 /len=600 Length = 600 Score = 61.9 bits (31), Expect = 1e-09 Identities = 37/39 (94%), Positives = 37/39 (94%) Query: 250 gtggcatatgcctttaatcccagcactcaggaggcagag 288 |||||| | |||||||||||||||||||||||||||||| Sbjct: 328 gtggcacacgcctttaatcccagcactcaggaggcagag 366 >gnl|UG|Rn.7869 EST208415 Rattus norvegicus cDNA, 3' end /clone=RSPBS28 /clone_end=3' /gb=AI013740 /gi=3227796 /len=539 Length = 539 Score = 61.9 bits (31), Expect = 1e-09 Identities = 40/43 (93%), Positives = 40/43 (93%) Query: 257 atgcctttaatcccagcactcaggaggcagagccaagtggatc 299 ||||||||||||| |||||||||||||||||| || ||||||| Sbjct: 490 atgcctttaatccaagcactcaggaggcagaggcaggtggatc 448 >gnl|UG|Rn.33651 UI-R-BT0-qe-d-09-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-BT0-qe-d-09-0-UI /clone_end=3' /gb=AI145386 /gi=3667185 /len=615 Length = 615 Score = 60.0 bits (30), Expect = 4e-09 Identities = 30/30 (100%), Positives = 30/30 (100%) Query: 259 gcctttaatcccagcactcaggaggcagag 288 |||||||||||||||||||||||||||||| Sbjct: 230 gcctttaatcccagcactcaggaggcagag 259 >gnl|UG|Rn.21293 UI-R-Y0-lt-b-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-Y0-lt-b-08-0-UI /clone_end=3' /gb=AI070369 /gi=3396620 /len=520 Length = 520 Score = 58.0 bits (29), Expect = 2e-08 Identities = 29/29 (100%), Positives = 29/29 (100%) Query: 260 cctttaatcccagcactcaggaggcagag 288 ||||||||||||||||||||||||||||| Sbjct: 146 cctttaatcccagcactcaggaggcagag 118 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3392 Number of Sequences: 23003 Number of extensions: 3392 Number of successful extensions: 1281 Number of sequences better than 10: 283 length of query: 302 length of database: 15818664 effective HSP length: 16 effective length of query: 286 effective length of database: 15450616 effective search space: 4418876176 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)