BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 953e03 (367 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.3550 EST197063 Rattus norvegicus cDNA, 3' end /clone=... 74 3e-13 gnl|UG|Rn.31761 C06749 Rattus norvegicus cDNA /gb=C06749 /gi=15... 64 3e-10 gnl|UG|Rn.30315 EST201331 Rattus norvegicus cDNA, 3' end /clone... 52 1e-06 gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone... 52 1e-06 gnl|UG|Rn.24760 EST230546 Rattus norvegicus cDNA, 3' end /clone... 46 7e-05 >gnl|UG|Rn.3550 EST197063 Rattus norvegicus cDNA, 3' end /clone=RKIBE21 /clone_end=3' /gb=AA893260 /gi=3020139 /len=514 Length = 514 Score = 73.8 bits (37), Expect = 3e-13 Identities = 46/49 (93%), Positives = 46/49 (93%) Query: 6 tcctgttctcagttcagtggtttgctgctggcaatggcctctgtatttg 54 |||| |||||||||||||||||||||||||||| | ||||||||||||| Sbjct: 350 tcctattctcagttcagtggtttgctgctggcattcgcctctgtatttg 302 >gnl|UG|Rn.31761 C06749 Rattus norvegicus cDNA /gb=C06749 /gi=1503525 /len=489 Length = 489 Score = 63.9 bits (32), Expect = 3e-10 Identities = 41/44 (93%), Positives = 41/44 (93%) Query: 11 ttctcagttcagtggtttgctgctggcaatggcctctgtatttg 54 |||||||||||||||||||||||||||| | |||||||||||| Sbjct: 337 ttctcagttcagtggtttgctgctggcattcacctctgtatttg 294 Score = 42.1 bits (21), Expect = 0.001 Identities = 38/44 (86%), Positives = 38/44 (86%) Query: 214 ccacatgtggggcaggctttgaatanccgttccttcagtttctg 257 |||||||||||||||||| ||||| ||||||||||| |||| Sbjct: 186 ccacatgtggggcaggctctgaatgggtgttccttcagtctctg 143 >gnl|UG|Rn.30315 EST201331 Rattus norvegicus cDNA, 3' end /clone=RLUAU76 /clone_end=3' /gb=AA945832 /gi=3105748 /len=452 Length = 452 Score = 52.0 bits (26), Expect = 1e-06 Identities = 92/114 (80%), Positives = 92/114 (80%) Query: 6 tcctgttctcagttcagtggtttgctgctggcaatggcctctgtatttgatatgttctga 65 ||||||||||||||||||||||| || ||||| | ||| |||||||| | | ||||| Sbjct: 317 tcctgttctcagttcagtggtttaatgatggcatttacctatgtatttgctgtattctgg 376 Query: 66 ctatatctctaaggatagacttatatcaggttcctgtcaccatgcacttcttag 119 || | ||||| |||| ||| || ||| |||||||||| | |||||||||||| Sbjct: 377 ctgtgtctctcaggagagatctacatccggttcctgtcggcctgcacttcttag 430 >gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone=RHEBX45 /clone_end=3' /gb=AI104113 /gi=3708524 /len=463 Length = 463 Score = 52.0 bits (26), Expect = 1e-06 Identities = 26/26 (100%), Positives = 26/26 (100%) Query: 12 tctcagttcagtggtttgctgctggc 37 |||||||||||||||||||||||||| Sbjct: 413 tctcagttcagtggtttgctgctggc 438 >gnl|UG|Rn.24760 EST230546 Rattus norvegicus cDNA, 3' end /clone=RLUCS07 /clone_end=3' /gb=AI233858 /gi=3817738 /len=430 Length = 430 Score = 46.1 bits (23), Expect = 7e-05 Identities = 23/23 (100%), Positives = 23/23 (100%) Query: 6 tcctgttctcagttcagtggttt 28 ||||||||||||||||||||||| Sbjct: 270 tcctgttctcagttcagtggttt 248 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2620 Number of Sequences: 23003 Number of extensions: 2620 Number of successful extensions: 673 Number of sequences better than 10: 26 length of query: 367 length of database: 15818664 effective HSP length: 16 effective length of query: 351 effective length of database: 15450616 effective search space: 5423166216 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)