BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 916h04 (299 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.13505 UI-R-BT0-px-h-08-0-UI.s1 Rattus norvegicus cDNA... 36 0.056 gnl|UG|Rn.32119 UI-R-E0-bv-f-10-0-UI.s1 Rattus norvegicus cDNA,... 32 0.88 gnl|UG|Rn.21131 UI-R-C1-lk-c-02-0-UI.s1 Rattus norvegicus cDNA,... 32 0.88 gnl|UG|Rn.27222 UI-R-C2p-nw-c-10-0-UI.s1 Rattus norvegicus cDNA... 30 3.5 gnl|UG|Rn.10597 Rattus norvegicus laminin-5 alpha 3 chain mRNA,... 30 3.5 >gnl|UG|Rn.13505 UI-R-BT0-px-h-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-BT0-px-h-08-0-UI /clone_end=3' /gb=AI145141 /gi=3666940 /len=515 Length = 515 Score = 36.2 bits (18), Expect = 0.056 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 30 ctaggattaaagttgtgtgcta 51 |||||||||||| ||||||||| Sbjct: 226 ctaggattaaaggtgtgtgcta 247 >gnl|UG|Rn.32119 UI-R-E0-bv-f-10-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E0-bv-f-10-0-UI /clone_end=3' /gb=AA859486 /gi=2949006 /len=479 Length = 479 Score = 32.2 bits (16), Expect = 0.88 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 30 ctaggattaaagttgtgtgc 49 |||||||||||| ||||||| Sbjct: 414 ctaggattaaaggtgtgtgc 433 >gnl|UG|Rn.21131 UI-R-C1-lk-c-02-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C1-lk-c-02-0-UI /clone_end=3' /gb=AI059712 /gi=3333489 /len=414 Length = 414 Score = 32.2 bits (16), Expect = 0.88 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 30 ctaggattaaagttgtgtgc 49 |||||||||||| ||||||| Sbjct: 115 ctaggattaaaggtgtgtgc 134 >gnl|UG|Rn.27222 UI-R-C2p-nw-c-10-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C2p-nw-c-10-0-UI /clone_end=3' /gb=AI136722 /gi=3637499 /len=562 Length = 562 Score = 30.2 bits (15), Expect = 3.5 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 33 ggattaaagttgtgt 47 ||||||||||||||| Sbjct: 38 ggattaaagttgtgt 24 >gnl|UG|Rn.10597 Rattus norvegicus laminin-5 alpha 3 chain mRNA, complete cds /cds=(58,5235) /gb=U61261 /gi=1620509 /len=5264 Length = 5264 Score = 30.2 bits (15), Expect = 3.5 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 265 aggatgctctcatag 279 ||||||||||||||| Sbjct: 1779 aggatgctctcatag 1765 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2739 Number of Sequences: 23003 Number of extensions: 2739 Number of successful extensions: 745 Number of sequences better than 10: 14 length of query: 299 length of database: 15818664 effective HSP length: 16 effective length of query: 283 effective length of database: 15450616 effective search space: 4372524328 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)