BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 915e04 (197 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.6384 Rat mRNA for neuronal high affinity glutamate tr... 72 7e-13 gnl|UG|Rn.26817 UI-R-Y0-mn-g-07-0-UI.s1 Rattus norvegicus cDNA,... 50 2e-06 gnl|UG|Rn.34185 EST229865 Rattus norvegicus cDNA, 3' end /clone... 46 4e-05 gnl|UG|Rn.28720 UI-R-BT0-qg-f-10-0-UI.s1 Rattus norvegicus cDNA... 40 0.002 gnl|UG|Rn.22693 EST219983 Rattus norvegicus cDNA, 3' end /clone... 38 0.009 >gnl|UG|Rn.6384 Rat mRNA for neuronal high affinity glutamate transporter, complete cds /cds=(120,1691) /gb=D63772 /gi=961490 /len=3775 Length = 3775 Score = 71.9 bits (36), Expect = 7e-13 Identities = 55/60 (91%), Positives = 55/60 (91%), Gaps = 1/60 (1%) Query: 4 gatctctgtgagtttgaggccagtctagtcta-acagagagttccaggacagacagggct 62 |||||||||||||||||||||||||||||||| | || ||||||||||| || ||||||| Sbjct: 3049 gatctctgtgagtttgaggccagtctagtctacatagtgagttccaggatagccagggct 2990 >gnl|UG|Rn.26817 UI-R-Y0-mn-g-07-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-Y0-mn-g-07-0-UI /clone_end=3' /gb=AI112566 /gi=3512515 /len=321 Length = 321 Score = 50.1 bits (25), Expect = 2e-06 Identities = 44/49 (89%), Positives = 44/49 (89%), Gaps = 1/49 (2%) Query: 12 tgagtttgaggccagtctagtcta-acagagagttccaggacagacagg 59 |||||||||||||||||| |||| | ||||||||||||||||| |||| Sbjct: 107 tgagtttgaggccagtctgatctacaaagagagttccaggacagccagg 59 >gnl|UG|Rn.34185 EST229865 Rattus norvegicus cDNA, 3' end /clone=RKICL81 /clone_end=3' /gb=AI233177 /gi=3817057 /len=557 Length = 557 Score = 46.1 bits (23), Expect = 4e-05 Identities = 48/54 (88%), Positives = 48/54 (88%), Gaps = 3/54 (5%) Query: 11 gtgagtttgaggccagtctagtctaacagag--agttccaggacagacagggct 62 ||||||||||||||||||| |||| |||||| | ||||||||||| ||||||| Sbjct: 91 gtgagtttgaggccagtctggtct-acagagtaaattccaggacagccagggct 143 >gnl|UG|Rn.28720 UI-R-BT0-qg-f-10-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-BT0-qg-f-10-0-UI /clone_end=3' /gb=AI146059 /gi=3667858 /len=481 Length = 481 Score = 40.1 bits (20), Expect = 0.002 Identities = 48/56 (85%), Positives = 48/56 (85%), Gaps = 1/56 (1%) Query: 8 tctgtgagtttgaggccagtctagtcta-acagagagttccaggacagacagggct 62 ||||||||||||||| ||| || ||||| | | |||||||||||||| ||||||| Sbjct: 147 tctgtgagtttgaggtcagcctggtctacatactgagttccaggacagccagggct 202 >gnl|UG|Rn.22693 EST219983 Rattus norvegicus cDNA, 3' end /clone=ROVBR29 /clone_end=3' /gb=AI176399 /gi=3727037 /len=518 Length = 518 Score = 38.2 bits (19), Expect = 0.009 Identities = 22/23 (95%), Positives = 22/23 (95%) Query: 4 gatctctgtgagtttgaggccag 26 |||||||||||||| |||||||| Sbjct: 422 gatctctgtgagttcgaggccag 400 Score = 36.2 bits (18), Expect = 0.036 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 41 gagttccaggacagacagggct 62 |||||||||||||| ||||||| Sbjct: 384 gagttccaggacagccagggct 363 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1437 Number of Sequences: 23003 Number of extensions: 1437 Number of successful extensions: 583 Number of sequences better than 10: 138 length of query: 197 length of database: 15818664 effective HSP length: 16 effective length of query: 181 effective length of database: 15450616 effective search space: 2796561496 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 14 (28.2 bits)