BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 878c08 (371 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.33923 EST219758 Rattus norvegicus cDNA, 3' end /clone... 60 5e-09 gnl|UG|Rn.25096 EST213644 Rattus norvegicus cDNA, 3' end /clone... 60 5e-09 gnl|UG|Rn.14794 EST196620 Rattus norvegicus cDNA, 3' end /clone... 56 8e-08 gnl|UG|Rn.31142 EST221005 Rattus norvegicus cDNA, 3' end /clone... 50 5e-06 gnl|UG|Rn.10158 Rattus norvegicus surface protein MCA-32 (MCA-3... 50 5e-06 >gnl|UG|Rn.33923 EST219758 Rattus norvegicus cDNA, 3' end /clone=ROVBL85 /clone_end=3' /gb=AI176177 /gi=3726815 /len=487 Length = 487 Score = 60.0 bits (30), Expect = 5e-09 Identities = 45/50 (90%), Positives = 45/50 (90%) Query: 108 agggttggagagatggctcagtgtttaacagcatggactgctctaccaga 157 |||| |||||||||||||||||| |||| |||| ||||||||||||||| Sbjct: 36 agggctggagagatggctcagtggttaagagcactgactgctctaccaga 85 >gnl|UG|Rn.25096 EST213644 Rattus norvegicus cDNA, 3' end /clone=RHECC24 /clone_end=3' /gb=AI104355 /gi=3708726 /len=468 Length = 468 Score = 60.0 bits (30), Expect = 5e-09 Identities = 45/50 (90%), Positives = 45/50 (90%) Query: 108 agggttggagagatggctcagtgtttaacagcatggactgctctaccaga 157 ||||||||||||||||||||||| |||| |||| ||||||||| ||||| Sbjct: 191 agggttggagagatggctcagtggttaagagcactgactgctcttccaga 240 >gnl|UG|Rn.14794 EST196620 Rattus norvegicus cDNA, 3' end /clone=RKIAX62 /clone_end=3' /gb=AA892817 /gi=3019696 /len=650 Length = 650 Score = 56.0 bits (28), Expect = 8e-08 Identities = 40/44 (90%), Positives = 40/44 (90%) Query: 108 agggttggagagatggctcagtgtttaacagcatggactgctct 151 |||| |||||||||||||||||| |||| ||||| ||||||||| Sbjct: 491 agggctggagagatggctcagtggttaagagcattgactgctct 534 >gnl|UG|Rn.31142 EST221005 Rattus norvegicus cDNA, 3' end /clone=RPLBY44 /clone_end=3' /gb=AI177385 /gi=3728023 /len=576 Length = 576 Score = 50.1 bits (25), Expect = 5e-06 Identities = 40/45 (88%), Positives = 40/45 (88%) Query: 113 tggagagatggctcagtgtttaacagcatggactgctctaccaga 157 |||||||||||||||||| |||| |||| ||||||||| ||||| Sbjct: 139 tggagagatggctcagtggttaagagcaccgactgctcttccaga 95 >gnl|UG|Rn.10158 Rattus norvegicus surface protein MCA-32 (MCA-32) mRNA, complete cds /cds=(21,827) /gb=U39546 /gi=1136500 /len=1659 Length = 1659 Score = 50.1 bits (25), Expect = 5e-06 Identities = 40/45 (88%), Positives = 40/45 (88%) Query: 113 tggagagatggctcagtgtttaacagcatggactgctctaccaga 157 |||||||||||||||||| |||| |||| ||||||||| ||||| Sbjct: 1398 tggagagatggctcagtggttaagagcactgactgctcttccaga 1442 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3346 Number of Sequences: 23003 Number of extensions: 3346 Number of successful extensions: 1152 Number of sequences better than 10: 197 length of query: 371 length of database: 15818664 effective HSP length: 16 effective length of query: 355 effective length of database: 15450616 effective search space: 5484968680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)