BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 787h04 (384 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.18760 UI-R-C0-jk-f-12-0-UI.s1 Rattus norvegicus cDNA,... 76 9e-14 gnl|UG|Rn.11914 UI-R-E1-gq-g-08-0-UI.s1 Rattus norvegicus cDNA,... 36 0.073 gnl|UG|Rn.8380 EST203611 Rattus norvegicus cDNA, 3' end /clone=... 34 0.29 gnl|UG|Rn.3175 EST221515 Rattus norvegicus cDNA, 3' end /clone=... 34 0.29 gnl|UG|Rn.11047 Rat sodium-hydrogen exchange protein-isoform 2 ... 34 0.29 >gnl|UG|Rn.18760 UI-R-C0-jk-f-12-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C0-jk-f-12-0-UI /clone_end=3' /gb=AI043947 /gi=3290682 /len=455 Length = 455 Score = 75.8 bits (38), Expect = 9e-14 Identities = 41/42 (97%), Positives = 41/42 (97%) Query: 20 ttggtgttttgttcaggaaattttttccagtgcccatgtgtt 61 |||||||||||||||||||||||| ||||||||||||||||| Sbjct: 455 ttggtgttttgttcaggaaattttctccagtgcccatgtgtt 414 >gnl|UG|Rn.11914 UI-R-E1-gq-g-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E1-gq-g-08-0-UI /clone_end=3' /gb=AA964789 /gi=3138281 /len=574 Length = 574 Score = 36.2 bits (18), Expect = 0.073 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 52 cccatgtgtttctccata 69 |||||||||||||||||| Sbjct: 234 cccatgtgtttctccata 217 >gnl|UG|Rn.8380 EST203611 Rattus norvegicus cDNA, 3' end /clone=REMBJ71 /clone_end=3' /gb=AI009160 /gi=3222992 /len=588 Length = 588 Score = 34.2 bits (17), Expect = 0.29 Identities = 26/28 (92%), Positives = 26/28 (92%), Gaps = 2/28 (7%) Query: 108 tgtccccgcgtgttttcttgctggcgag 135 |||||||||||| |||||||||||||| Sbjct: 195 tgtccccgcgtg--ttcttgctggcgag 170 >gnl|UG|Rn.3175 EST221515 Rattus norvegicus cDNA, 3' end /clone=RPLCH60 /clone_end=3' /gb=AI177866 /gi=3728504 /len=675 Length = 675 Score = 34.2 bits (17), Expect = 0.29 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 68 taagattttaataaaagtttg 88 |||||||| |||||||||||| Sbjct: 26 taagatttaaataaaagtttg 6 >gnl|UG|Rn.11047 Rat sodium-hydrogen exchange protein-isoform 2 (NHE-2) mRNA, complete cds /cds=(546,2639) /gb=L11004 /gi=986944 /len=3941 Length = 3941 Score = 34.2 bits (17), Expect = 0.29 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 298 tggcattgggctgtctt 314 ||||||||||||||||| Sbjct: 747 tggcattgggctgtctt 763 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3484 Number of Sequences: 23003 Number of extensions: 3484 Number of successful extensions: 984 Number of sequences better than 10: 41 length of query: 384 length of database: 15818664 effective HSP length: 16 effective length of query: 368 effective length of database: 15450616 effective search space: 5685826688 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)