BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 772b02 (275 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.12060 EST206851 Rattus norvegicus cDNA, 3' end /clone... 68 1e-11 gnl|UG|Rn.10018 Rattus norvegicus (clone erb62) thyroid (T3) ho... 36 0.052 gnl|UG|Rn.32649 UI-R-A1-en-a-07-0-UI.s1 Rattus norvegicus cDNA,... 34 0.20 gnl|UG|Rn.9416 Rattus norvegicus gamma-adducin mRNA, complete c... 34 0.20 gnl|UG|Rn.15933 UI-R-C1-kc-c-08-0-UI.s1 Rattus norvegicus cDNA,... 34 0.20 >gnl|UG|Rn.12060 EST206851 Rattus norvegicus cDNA, 3' end /clone=RPLAW66 /clone_end=3' /gb=AI012400 /gi=3226232 /len=516 Length = 516 Score = 67.9 bits (34), Expect = 1e-11 Identities = 40/42 (95%), Positives = 40/42 (95%) Query: 228 tctctgctcccaaaccccgtgggagagagacctcaccgcctg 269 |||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 191 tctctgctcccagaccccgtgggaaagagacctcaccgcctg 232 >gnl|UG|Rn.10018 Rattus norvegicus (clone erb62) thyroid (T3) hormone receptor mRNA, complete cds /cds=(249,1634) /gb=J03819 /gi=623566 /len=4535 Length = 4535 Score = 36.2 bits (18), Expect = 0.052 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 227 gtctctgctcccaaaccc 244 |||||||||||||||||| Sbjct: 2741 gtctctgctcccaaaccc 2758 >gnl|UG|Rn.32649 UI-R-A1-en-a-07-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-A1-en-a-07-0-UI /clone_end=3' /gb=AA925131 /gi=3072267 /len=447 Length = 447 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 197 gtaaatgttcatattaa 213 ||||||||||||||||| Sbjct: 121 gtaaatgttcatattaa 137 >gnl|UG|Rn.9416 Rattus norvegicus gamma-adducin mRNA, complete cds /cds=(133,2148) /gb=U35775 /gi=1041239 /len=2246 Length = 2246 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 176 ttctgatgggaacccat 192 ||||||||||||||||| Sbjct: 1221 ttctgatgggaacccat 1205 >gnl|UG|Rn.15933 UI-R-C1-kc-c-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C1-kc-c-08-0-UI /clone_end=3' /gb=AI044521 /gi=3291382 /len=475 Length = 475 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 210 ttaagagattcaggata 226 ||||||||||||||||| Sbjct: 406 ttaagagattcaggata 390 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1470 Number of Sequences: 23003 Number of extensions: 1470 Number of successful extensions: 425 Number of sequences better than 10: 14 length of query: 275 length of database: 15818664 effective HSP length: 16 effective length of query: 259 effective length of database: 15450616 effective search space: 4001709544 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)