BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 165h09 (549 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.31772 Rattus norvegicus clone BB.1.4.1 unknown Glu-Pr... 163 7e-40 gnl|UG|Rn.9093 EST213659 Rattus norvegicus cDNA, 3' end /clone=... 36 0.11 gnl|UG|Rn.16996 UI-R-E0-cj-c-11-0-UI.s1 Rattus norvegicus cDNA,... 32 1.7 gnl|UG|Rn.23714 UI-R-C2p-nz-1-c-01-0-UI.s1 Rattus norvegicus cD... 32 1.7 gnl|UG|Rn.33357 UI-R-C1-ke-g-07-0-UI.s1 Rattus norvegicus cDNA,... 32 1.7 >gnl|UG|Rn.31772 Rattus norvegicus clone BB.1.4.1 unknown Glu-Pro dipeptide repeat protein mRNA, complete cds /cds=(675,1094) /gb=U40628 /gi=1184695 /len=1876 Length = 1876 Score = 163 bits (82), Expect = 7e-40 Identities = 118/127 (92%), Positives = 118/127 (92%), Gaps = 3/127 (2%) Query: 158 gaaaccagttgttagggggntcga-tccttcctttnttatttgactttttacataggaag 216 |||||||||||| |||||| |||| |||||||||| |||||| |||||| || ||||||| Sbjct: 655 gaaaccagttgt-agggggttcgaatccttcctttcttatttaactttt-acgtaggaag 598 Query: 217 gttnttcgaatgtgtggtagggtggggggcatccatgcagtcattataggttagttgagg 276 ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 597 gttcttcgaatgtgtggtagggtggggggcatccatgcagtcattctaggttagttgagg 538 Query: 277 agtagga 283 ||||||| Sbjct: 537 agtagga 531 >gnl|UG|Rn.9093 EST213659 Rattus norvegicus cDNA, 3' end /clone=RHECC41 /clone_end=3' /gb=AI104370 /gi=3708740 /len=460 Length = 460 Score = 36.2 bits (18), Expect = 0.11 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 230 gtggtagggtggggggca 247 |||||||||||||||||| Sbjct: 312 gtggtagggtggggggca 295 >gnl|UG|Rn.16996 UI-R-E0-cj-c-11-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E0-cj-c-11-0-UI /clone_end=3' /gb=AA859317 /gi=2948668 /len=510 Length = 510 Score = 32.2 bits (16), Expect = 1.7 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 525 ttcttttttgaaacat 540 |||||||||||||||| Sbjct: 285 ttcttttttgaaacat 270 >gnl|UG|Rn.23714 UI-R-C2p-nz-1-c-01-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C2p-nz-1-c-01-0-UI /clone_end=3' /gb=AI136798 /len=335 Length = 335 Score = 32.2 bits (16), Expect = 1.7 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 198 tgactttttacatagg 213 |||||||||||||||| Sbjct: 120 tgactttttacatagg 105 >gnl|UG|Rn.33357 UI-R-C1-ke-g-07-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C1-ke-g-07-0-UI /clone_end=3' /gb=AI045005 /gi=3291824 /len=270 Length = 270 Score = 32.2 bits (16), Expect = 1.7 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 525 ttcttttttgaaacat 540 |||||||||||||||| Sbjct: 49 ttcttttttgaaacat 64 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2760 Number of Sequences: 23003 Number of extensions: 2760 Number of successful extensions: 202 Number of sequences better than 10: 5 length of query: 549 length of database: 15818664 effective HSP length: 17 effective length of query: 532 effective length of database: 15427613 effective search space: 8207490116 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)