BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D2Rat46 (636 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.33793 EST213799 Rattus norvegicus cDNA, 3' end /clone... 107 4e-23 gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone... 88 4e-17 gnl|UG|Rn.32900 UI-R-E1-ge-f-01-0-UI.s1 Rattus norvegicus cDNA,... 86 1e-16 gnl|UG|Rn.14794 EST196620 Rattus norvegicus cDNA, 3' end /clone... 52 2e-06 gnl|UG|Rn.17874 EST207101 Rattus norvegicus cDNA, 3' end /clone... 42 0.002 >gnl|UG|Rn.33793 EST213799 Rattus norvegicus cDNA, 3' end /clone=RHECE47 /clone_end=3' /gb=AI104510 /gi=3708854 /len=364 Length = 364 Score = 107 bits (54), Expect = 4e-23 Identities = 60/62 (96%), Positives = 60/62 (96%) Query: 51 aacaatcacgttcactgggagttcagtcttggcaggacccagggcttccccttccactgg 110 ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| Sbjct: 169 aacaatcacgttcactgggggttcagtcttagcaggacccagggcttccccttccactgg 228 Query: 111 tg 112 || Sbjct: 229 tg 230 >gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone=RHEBX45 /clone_end=3' /gb=AI104113 /gi=3708524 /len=463 Length = 463 Score = 87.7 bits (44), Expect = 4e-17 Identities = 56/60 (93%), Positives = 56/60 (93%) Query: 53 caatcacgttcactgggagttcagtcttggcaggacccagggcttccccttccactggtg 112 |||||| |||||||||| |||||||||| |||||||| |||||||||||||||||||||| Sbjct: 172 caatcaagttcactgggggttcagtcttagcaggaccaagggcttccccttccactggtg 231 >gnl|UG|Rn.32900 UI-R-E1-ge-f-01-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E1-ge-f-01-0-UI /clone_end=3' /gb=AA957137 /gi=3120832 /len=360 Length = 360 Score = 85.7 bits (43), Expect = 1e-16 Identities = 52/55 (94%), Positives = 52/55 (94%) Query: 61 ttcactgggagttcagtcttggcaggacccagggcttccccttccactggtgctc 115 ||||||||| |||||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 352 ttcactgggtgttcagtcttagcaggaccaagggcttccccttccactggtgctc 298 >gnl|UG|Rn.14794 EST196620 Rattus norvegicus cDNA, 3' end /clone=RKIAX62 /clone_end=3' /gb=AA892817 /gi=3019696 /len=650 Length = 650 Score = 52.0 bits (26), Expect = 2e-06 Identities = 41/46 (89%), Positives = 41/46 (89%) Query: 113 ctcacaaccatctataattggatctgacgctctcctcgggtgtgtc 158 |||||||||||||||||| |||||||| || ||| || |||||||| Sbjct: 576 ctcacaaccatctataatgggatctgatgccctcttctggtgtgtc 621 >gnl|UG|Rn.17874 EST207101 Rattus norvegicus cDNA, 3' end /clone=RPLBA04 /clone_end=3' /gb=AI012650 /gi=3226482 /len=447 Length = 447 Score = 42.1 bits (21), Expect = 0.002 Identities = 39/45 (86%), Positives = 39/45 (86%) Query: 114 tcacaaccatctataattggatctgacgctctcctcgggtgtgtc 158 |||||||||||| |||| |||||||| || ||| || |||||||| Sbjct: 400 tcacaaccatctgtaatgggatctgatgccctcttctggtgtgtc 356 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5910 Number of Sequences: 23003 Number of extensions: 5910 Number of successful extensions: 894 Number of sequences better than 10: 98 length of query: 636 length of database: 15818664 effective HSP length: 17 effective length of query: 619 effective length of database: 15427613 effective search space: 9549692447 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)