BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 952a07 (277 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.3388 vc21a02.r1 Mus musculus cDNA, 5' end /clone=IMAG... 149 5e-36 gnl|UG|Mm.4408 M.musculus mRNA for CLCN4 /cds=(377,2620) /gb=Z4... 32 0.82 gnl|UG|Mm.20470 Mus musculus neuronal apoptosis inhibitory prot... 32 0.82 >gnl|UG|Mm.3388 vc21a02.r1 Mus musculus cDNA, 5' end /clone=IMAGE:775178 /clone_end=5' /gb=AA386928 /gi=2040016 /len=375 Length = 375 Score = 149 bits (75), Expect = 5e-36 Identities = 135/155 (87%), Positives = 135/155 (87%) Query: 6 tccctattgcaatttaatttgtcctgctctgggtccaaaggtggtggtgatttgggacca 65 ||||| |||| |||| ||||||||| ||||||| ||||||| ||||||| |||| | ||| Sbjct: 318 tccctgttgcgatttcatttgtcctactctgggcccaaaggaggtggtggtttgaggcca 259 Query: 66 tccagaggactacctcagaccatgtggcagctggcgggcccaggatactttgcttctgga 125 ||||||||||| |||| ||||||| ||||||||| |||||||||| || || ||||||| Sbjct: 258 tccagaggactgcctcggaccatgcggcagctggaaggcccaggatgctgtgtttctgga 199 Query: 126 cttgtctgggaatggcccggaagacaccactttcc 160 |||| |||||||||||| ||||||| ||||||||| Sbjct: 198 cttggctgggaatggcctggaagacgccactttcc 164 Score = 73.8 bits (37), Expect = 2e-13 Identities = 49/53 (92%), Positives = 49/53 (92%) Query: 222 gagaactgcttttcatgctgggatgagacctcttccagttggtctaggccctg 274 ||||||||||||||| ||||||||||||||||||||| ||| |||||||||| Sbjct: 138 gagaactgcttttcagcctgggatgagacctcttccagatggcctaggccctg 86 >gnl|UG|Mm.4408 M.musculus mRNA for CLCN4 /cds=(377,2620) /gb=Z49916 /gi=929679 /len=2724 Length = 2724 Score = 32.2 bits (16), Expect = 0.82 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 85 ccatgtggcagctggc 100 |||||||||||||||| Sbjct: 1660 ccatgtggcagctggc 1675 >gnl|UG|Mm.20470 Mus musculus neuronal apoptosis inhibitory protein 2 (Naip2) mRNA, complete cds /cds=(172,4515) /gb=AF102871 /gi=3860228 /len=4815 Length = 4815 Score = 32.2 bits (16), Expect = 0.82 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 56 tttgggaccatccaga 71 |||||||||||||||| Sbjct: 3012 tttgggaccatccaga 3027 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2442 Number of Sequences: 15275 Number of extensions: 2442 Number of successful extensions: 653 Number of sequences better than 10: 9 length of query: 277 length of database: 15836343 effective HSP length: 16 effective length of query: 261 effective length of database: 15591943 effective search space: 4069497123 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)