BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 905c01 (380 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.4415 Kinesin heavy chain member 2 /cds=(504,2654) /gb... 101 1e-21 gnl|UG|Mm.30223 mp53b09.x1 Mus musculus cDNA, 3' end /clone=IMA... 38 0.019 gnl|UG|Mm.25947 AU015907 Mus musculus cDNA, 3' end /clone=J0718... 36 0.073 gnl|UG|Mm.13724 Mus musculus putative membrane-associated guany... 34 0.29 gnl|UG|Mm.4278 Potassium inwardly-rectifying channel, subfamily... 30 4.5 >gnl|UG|Mm.4415 Kinesin heavy chain member 2 /cds=(504,2654) /gb=D12644 /gi=220467 /len=3532 Length = 3532 Score = 101 bits (51), Expect = 1e-21 Identities = 69/75 (92%), Positives = 69/75 (92%) Query: 11 ggtgagcctttcagttctggattgcagttcattccagatatagtcaagcggacaaccagg 70 |||||||||| || |||||||||| ||||||||||| ||||||||||| |||||||||| Sbjct: 266 ggtgagccttccaattctggattgtagttcattccaaatatagtcaagttgacaaccagg 207 Query: 71 aatagccactacacc 85 ||||||||||||||| Sbjct: 206 aatagccactacacc 192 >gnl|UG|Mm.30223 mp53b09.x1 Mus musculus cDNA, 3' end /clone=IMAGE:572921 /clone_end=3' /gb=AI428907 /len=463 Length = 463 Score = 38.2 bits (19), Expect = 0.019 Identities = 25/27 (92%), Positives = 25/27 (92%) Query: 29 ggattgcagttcattccagatatagtc 55 |||||| |||||||||||||| ||||| Sbjct: 237 ggattgtagttcattccagatgtagtc 211 >gnl|UG|Mm.25947 AU015907 Mus musculus cDNA, 3' end /clone=J0718C01 /clone_end=3' /gb=AU015907 /gi=3370698 /len=426 Length = 426 Score = 36.2 bits (18), Expect = 0.073 Identities = 24/26 (92%), Positives = 24/26 (92%) Query: 24 gttctggattgcagttcattccagat 49 ||||||||||| || ||||||||||| Sbjct: 127 gttctggattgtagctcattccagat 152 >gnl|UG|Mm.13724 Mus musculus putative membrane-associated guanylate kinase 1 (Magi-1) mRNA, alternatively spliced b form, complete cds /cds=(924,4439) /gb=AF027503 /gi=2702346 /len=5350 Length = 5350 Score = 34.2 bits (17), Expect = 0.29 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 267 caggaggcacaacagat 283 ||||||||||||||||| Sbjct: 2170 caggaggcacaacagat 2154 >gnl|UG|Mm.4278 Potassium inwardly-rectifying channel, subfamily J, member 9 /cds=(307,1437) /gb=U11860 /gi=576452 /len=2267 Length = 2267 Score = 30.2 bits (15), Expect = 4.5 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 98 gagaggtcagaaagg 112 ||||||||||||||| Sbjct: 2081 gagaggtcagaaagg 2095 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2862 Number of Sequences: 15275 Number of extensions: 2862 Number of successful extensions: 778 Number of sequences better than 10: 16 length of query: 380 length of database: 15836343 effective HSP length: 16 effective length of query: 364 effective length of database: 15591943 effective search space: 5675467252 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)