BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 716f02 (327 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.10079 vw58d08.s1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.25 gnl|UG|Mm.2133 mv91f04.r1 Mus musculus cDNA, 5' end /clone=IMAG... 32 0.98 gnl|UG|Mm.27824 ui44d12.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 0.98 gnl|UG|Mm.1376 CAMP responsive element binding protein 1 /cds=(... 32 0.98 gnl|UG|Mm.26916 uj37b07.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 0.98 >gnl|UG|Mm.10079 vw58d08.s1 Mus musculus cDNA, 3' end /clone=IMAGE:1248015 /clone_end=3' /gb=AA959901 /gi=3125801 /len=552 Length = 552 Score = 34.2 bits (17), Expect = 0.25 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 109 acacacctacccacaca 125 ||||||||||||||||| Sbjct: 48 acacacctacccacaca 32 >gnl|UG|Mm.2133 mv91f04.r1 Mus musculus cDNA, 5' end /clone=IMAGE:662431 /clone_end=5' /gb=AA208211 /gi=1804689 /len=390 Length = 390 Score = 32.2 bits (16), Expect = 0.98 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 10 attaaaggatagaacc 25 |||||||||||||||| Sbjct: 147 attaaaggatagaacc 162 >gnl|UG|Mm.27824 ui44d12.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1885271 /clone_end=3' /gb=AI117679 /gi=3518003 /len=488 Length = 488 Score = 32.2 bits (16), Expect = 0.98 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 127 agaataaataaatgtt 142 |||||||||||||||| Sbjct: 37 agaataaataaatgtt 22 >gnl|UG|Mm.1376 CAMP responsive element binding protein 1 /cds=(135,1160) /gb=M95106 /gi=192713 /len=1258 Length = 1258 Score = 32.2 bits (16), Expect = 0.98 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 132 aaataaatgtttactt 147 |||||||||||||||| Sbjct: 1240 aaataaatgtttactt 1225 >gnl|UG|Mm.26916 uj37b07.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1922101 /clone_end=3' /gb=AI315318 /len=457 Length = 457 Score = 32.2 bits (16), Expect = 0.98 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 120 cacacacagaataaataaat 139 |||||||| ||||||||||| Sbjct: 52 cacacacacaataaataaat 33 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1820 Number of Sequences: 15275 Number of extensions: 1820 Number of successful extensions: 423 Number of sequences better than 10: 10 length of query: 327 length of database: 15836343 effective HSP length: 16 effective length of query: 311 effective length of database: 15591943 effective search space: 4849094273 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)