BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 301b08 (316 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.23372 mm31g08.x1 Mus musculus cDNA, 3' end /clone=IMA... 46 6e-05 gnl|UG|Mm.1346 Integrin alpha 4 (Cd49d) /cds=(137,3256) /gb=X53... 46 6e-05 gnl|UG|Mm.24664 vg09e05.r1 Mus musculus cDNA, 5' end /clone=IMA... 42 0.001 gnl|UG|Mm.25900 AU015180 Mus musculus cDNA, 3' end /clone=J0708... 42 0.001 gnl|UG|Mm.26335 AU022824 Mus musculus cDNA, 3' end /clone=J0421... 40 0.004 >gnl|UG|Mm.23372 mm31g08.x1 Mus musculus cDNA, 3' end /clone=IMAGE:523166 /clone_end=3' /gb=AI427963 /len=332 Length = 332 Score = 46.1 bits (23), Expect = 6e-05 Identities = 31/34 (91%), Positives = 31/34 (91%) Query: 279 tctttatttacntttcaaatgttactccctttcc 312 ||||||||||| |||||||||||| |||||||| Sbjct: 14 tctttatttacatttcaaatgttatcccctttcc 47 >gnl|UG|Mm.1346 Integrin alpha 4 (Cd49d) /cds=(137,3256) /gb=X53176 /gi=51484 /len=4829 Length = 4829 Score = 46.1 bits (23), Expect = 6e-05 Identities = 31/34 (91%), Positives = 31/34 (91%) Query: 279 tctttatttacntttcaaatgttactccctttcc 312 ||||||||||| |||||||||||| |||||||| Sbjct: 3730 tctttatttacatttcaaatgttatcccctttcc 3763 >gnl|UG|Mm.24664 vg09e05.r1 Mus musculus cDNA, 5' end /clone=IMAGE:860864 /clone_end=5' /gb=AA500239 /gi=2235206 /len=462 Length = 462 Score = 42.1 bits (21), Expect = 0.001 Identities = 23/24 (95%), Positives = 23/24 (95%) Query: 279 tctttatttacntttcaaatgtta 302 ||||||||||| |||||||||||| Sbjct: 92 tctttatttacatttcaaatgtta 115 >gnl|UG|Mm.25900 AU015180 Mus musculus cDNA, 3' end /clone=J0708G06 /clone_end=3' /gb=AU015180 /gi=3369971 /len=585 Length = 585 Score = 42.1 bits (21), Expect = 0.001 Identities = 29/32 (90%), Positives = 29/32 (90%) Query: 281 tttatttacntttcaaatgttactccctttcc 312 ||||||||| |||||||||||| |||||||| Sbjct: 35 tttatttacatttcaaatgttatcccctttcc 66 >gnl|UG|Mm.26335 AU022824 Mus musculus cDNA, 3' end /clone=J0421B06 /clone_end=3' /gb=AU022824 /gi=3393171 /len=593 Length = 593 Score = 40.1 bits (20), Expect = 0.004 Identities = 31/35 (88%), Positives = 31/35 (88%) Query: 279 tctttatttacntttcaaatgttactccctttccc 313 |||||||||| |||||||||||| ||||||||| Sbjct: 12 tctttatttaaatttcaaatgttatcccctttccc 46 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3320 Number of Sequences: 15275 Number of extensions: 3320 Number of successful extensions: 934 Number of sequences better than 10: 39 length of query: 316 length of database: 15836343 effective HSP length: 16 effective length of query: 300 effective length of database: 15591943 effective search space: 4677582900 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)