BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 184h01 (245 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.24964 C77902 Mus musculus cDNA, 3' end /clone=J0039D1... 56 5e-08 gnl|UG|Mm.8022 Mus musculus strain C57BL/6 zinc finger protein ... 54 2e-07 gnl|UG|Mm.25983 AU016428 Mus musculus cDNA, 3' end /clone=J0724... 48 1e-05 gnl|UG|Mm.17862 AU045717 Mus musculus cDNA, 3' end /clone=J0940... 46 5e-05 gnl|UG|Mm.27079 uc73g04.x1 Mus musculus cDNA, 3' end /clone=IMA... 38 0.012 >gnl|UG|Mm.24964 C77902 Mus musculus cDNA, 3' end /clone=J0039D11 /clone_end=3' /gb=C77902 /gi=2518232 /len=583 Length = 583 Score = 56.0 bits (28), Expect = 5e-08 Identities = 55/64 (85%), Positives = 55/64 (85%) Query: 16 tttataaggcttgcattggtcatggtgtctgttcacagcaataaggccctatctaagaca 75 |||||||| |||| ||||||||||||||| |||| |||||||| ||||| ||||||| Sbjct: 238 tttataagagttgccttggtcatggtgtctcttcatagcaataaaaccctaattaagaca 179 Query: 76 gtaa 79 |||| Sbjct: 178 gtaa 175 >gnl|UG|Mm.8022 Mus musculus strain C57BL/6 zinc finger protein 106 (Zfp106) mRNA, H3a-a allele, complete cds /cds=(2290,7956) /gb=AF060246 /gi=3372656 /len=8428 Length = 8428 Score = 54.0 bits (27), Expect = 2e-07 Identities = 51/59 (86%), Positives = 51/59 (86%) Query: 17 ttataaggcttgcattggtcatggtgtctgttcacagcaataaggccctatctaagaca 75 ||||||| |||| ||||||||||| ||||||||||||| ||| ||||| |||||||| Sbjct: 1223 ttataagagttgccttggtcatggtatctgttcacagcagtaaaaccctaactaagaca 1281 >gnl|UG|Mm.25983 AU016428 Mus musculus cDNA, 3' end /clone=J0724H10 /clone_end=3' /gb=AU016428 /gi=3371432 /len=498 Length = 498 Score = 48.1 bits (24), Expect = 1e-05 Identities = 30/32 (93%), Positives = 30/32 (93%) Query: 26 ttgcattggtcatggtgtctgttcacagcaat 57 |||| ||||||||||||||| ||||||||||| Sbjct: 245 ttgccttggtcatggtgtctcttcacagcaat 214 >gnl|UG|Mm.17862 AU045717 Mus musculus cDNA, 3' end /clone=J0940C05 /clone_end=3' /gb=AU045717 /gi=3981900 /len=405 Length = 405 Score = 46.1 bits (23), Expect = 5e-05 Identities = 47/55 (85%), Positives = 47/55 (85%) Query: 1 aattaaatgctgtcctttataaggcttgcattggtcatggtgtctgttcacagca 55 ||||||||| |||||||| ||| |||| ||||||||||||||| ||| ||||| Sbjct: 137 aattaaatgttgtcctttgtaatagttgccttggtcatggtgtctcttcccagca 83 >gnl|UG|Mm.27079 uc73g04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1431318 /clone_end=3' /gb=AA986740 /gi=3167742 /len=563 Length = 563 Score = 38.2 bits (19), Expect = 0.012 Identities = 25/27 (92%), Positives = 25/27 (92%) Query: 31 ttggtcatggtgtctgttcacagcaat 57 |||||||||||||| ||||||||||| Sbjct: 414 ttggtcatggtgtcccttcacagcaat 388 Score = 30.2 bits (15), Expect = 2.8 Identities = 21/23 (91%), Positives = 21/23 (91%) Query: 1 aattaaatgctgtcctttataag 23 |||| |||| ||||||||||||| Sbjct: 454 aattgaatggtgtcctttataag 432 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1670 Number of Sequences: 15275 Number of extensions: 1670 Number of successful extensions: 445 Number of sequences better than 10: 21 length of query: 245 length of database: 15836343 effective HSP length: 16 effective length of query: 229 effective length of database: 15591943 effective search space: 3570554947 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)