BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 138a02 (265 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.27610 mr03b12.r1 Mus musculus cDNA, 5' end /clone=IMA... 42 8e-04 gnl|UG|Mm.4086 vd54e09.r1 Mus musculus cDNA, 5' end /clone=IMAG... 36 0.050 gnl|UG|Mm.3448 Interleukin 5 receptor, alpha /cds=(302,1549) /g... 34 0.20 gnl|UG|Mm.3179 Immunoglobulin S mu binding protein 2 /cds=(120,... 30 3.1 >gnl|UG|Mm.27610 mr03b12.r1 Mus musculus cDNA, 5' end /clone=IMAGE:596351 /clone_end=5' /gb=AA122819 /gi=1681776 /len=541 Length = 541 Score = 42.1 bits (21), Expect = 8e-04 Identities = 36/41 (87%), Positives = 36/41 (87%) Query: 94 gtggggcaggctctgaatggctgttccttcagtctctgctc 134 ||||||||| ||||| |||| |||||||||||||||||| Sbjct: 32 gtggggcagtctctggatggtccttccttcagtctctgctc 72 >gnl|UG|Mm.4086 vd54e09.r1 Mus musculus cDNA, 5' end /clone=IMAGE:804424 /clone_end=5' /gb=AA474745 /gi=2202900 /len=438 Length = 438 Score = 36.2 bits (18), Expect = 0.050 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 124 agtctctgctctaaactt 141 |||||||||||||||||| Sbjct: 285 agtctctgctctaaactt 302 >gnl|UG|Mm.3448 Interleukin 5 receptor, alpha /cds=(302,1549) /gb=D90205 /gi=220465 /len=3553 Length = 3553 Score = 34.2 bits (17), Expect = 0.20 Identities = 26/29 (89%), Positives = 26/29 (89%) Query: 201 atccacatttttgtcatccttcttcttga 229 ||||||| ||| ||| ||||||||||||| Sbjct: 3324 atccacactttggtcttccttcttcttga 3352 >gnl|UG|Mm.3179 Immunoglobulin S mu binding protein 2 /cds=(120,3101) /gb=L10075 /gi=293805 /len=5459 Length = 5459 Score = 30.2 bits (15), Expect = 3.1 Identities = 24/27 (88%), Positives = 24/27 (88%) Query: 201 atccacatttttgtcatccttcttctt 227 ||||||| ||| ||| ||||||||||| Sbjct: 5281 atccacactttggtcttccttcttctt 5307 Score = 30.2 bits (15), Expect = 3.1 Identities = 24/27 (88%), Positives = 24/27 (88%) Query: 104 ctctgaatggctgttccttcagtctct 130 ||||| ||||| |||||||||||||| Sbjct: 5187 ctctggatggcctttccttcagtctct 5213 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2359 Number of Sequences: 15275 Number of extensions: 2359 Number of successful extensions: 645 Number of sequences better than 10: 19 length of query: 265 length of database: 15836343 effective HSP length: 16 effective length of query: 249 effective length of database: 15591943 effective search space: 3882393807 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)