BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 130b08 (185 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.27179 C79562 Mus musculus cDNA, 3' end /clone=J0068B0... 58 9e-09 gnl|UG|Mm.24480 EST02337 Mus musculus cDNA, 3' end /clone=C0020... 52 6e-07 gnl|UG|Mm.2309 Hyaluronan mediated motility receptor (RHAMM) /c... 50 2e-06 gnl|UG|Mm.26832 AU017007 Mus musculus cDNA, 3' end /clone=J0733... 50 2e-06 gnl|UG|Mm.24556 vj89c05.r1 Mus musculus cDNA, 3' end /clone=IMA... 50 2e-06 >gnl|UG|Mm.27179 C79562 Mus musculus cDNA, 3' end /clone=J0068B07 /clone_end=3' /gb=C79562 /gi=2519892 /len=563 Length = 563 Score = 58.0 bits (29), Expect = 9e-09 Identities = 45/49 (91%), Positives = 45/49 (91%), Gaps = 1/49 (2%) Query: 19 gtgctacagagggcagagctggagaagtgactccagccctttggaggag 67 |||||||||| |||||||||||||||||||| ||| |||||||||||| Sbjct: 197 gtgctacagaaggcagagctggagaagtgac-ccaagcctttggaggag 150 >gnl|UG|Mm.24480 EST02337 Mus musculus cDNA, 3' end /clone=C0020C03 /clone_end=3' /gb=AA407735 /gi=2067252 /len=502 Length = 502 Score = 52.0 bits (26), Expect = 6e-07 Identities = 48/54 (88%), Positives = 48/54 (88%), Gaps = 1/54 (1%) Query: 19 gtgctacagagggcagagctggagaagtgactccagccctttggaggagcccaa 72 |||||||| ||| ||| |||||||||||||| | ||||| |||||||||||||| Sbjct: 71 gtgctacaaaggacagggctggagaagtgacccaagccc-ttggaggagcccaa 19 >gnl|UG|Mm.2309 Hyaluronan mediated motility receptor (RHAMM) /cds=(63,2447) /gb=AF031932 /gi=3025338 /len=3539 Length = 3539 Score = 50.1 bits (25), Expect = 2e-06 Identities = 37/41 (90%), Positives = 37/41 (90%) Query: 19 gtgctacagagggcagagctggagaagtgactccagccctt 59 |||||||| ||||||||||| |||||||||| | ||||||| Sbjct: 3317 gtgctacaaagggcagagctagagaagtgacccaagccctt 3277 >gnl|UG|Mm.26832 AU017007 Mus musculus cDNA, 3' end /clone=J0733A11 /clone_end=3' /gb=AU017007 /gi=3372011 /len=590 Length = 590 Score = 50.1 bits (25), Expect = 2e-06 Identities = 47/53 (88%), Positives = 47/53 (88%), Gaps = 1/53 (1%) Query: 19 gtgctacagagggcagagctggagaagtgactccagccctttggaggagccca 71 |||||||| |||||| |||||||||||||| | ||||| ||||||||||||| Sbjct: 149 gtgctacaaagggcatggctggagaagtgacccaagccc-ttggaggagccca 98 >gnl|UG|Mm.24556 vj89c05.r1 Mus musculus cDNA, 3' end /clone=IMAGE:944264 /clone_end=3' /gb=AA536877 /gi=2282870 /len=632 Length = 632 Score = 50.1 bits (25), Expect = 2e-06 Identities = 40/45 (88%), Positives = 40/45 (88%) Query: 19 gtgctacagagggcagagctggagaagtgactccagccctttgga 63 ||||| || |||||||||||||| ||||||| | ||||||||||| Sbjct: 511 gtgctgcaaagggcagagctggaaaagtgacccaagccctttgga 555 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1529 Number of Sequences: 15275 Number of extensions: 1529 Number of successful extensions: 475 Number of sequences better than 10: 26 length of query: 185 length of database: 15836343 effective HSP length: 16 effective length of query: 169 effective length of database: 15591943 effective search space: 2635038367 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 14 (28.2 bits)