BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 084g07 (276 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.29580 mb55c11.r1 Mus musculus cDNA, 5' end /clone=IMA... 94 3e-19 gnl|UG|Mm.7165 mb97d12.y1 Mus musculus cDNA, 5' end /clone=IMAG... 34 0.21 gnl|UG|Mm.30021 ue13d03.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 0.82 gnl|UG|Mm.23281 mn38c04.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 0.82 gnl|UG|Mm.16469 Mouse N-myc gene /cds=(349,1737) /gb=X03919 /gi... 32 0.82 >gnl|UG|Mm.29580 mb55c11.r1 Mus musculus cDNA, 5' end /clone=IMAGE:333332 /clone_end=5' /gb=W15822 /gi=1290278 /len=972 Length = 972 Score = 93.7 bits (47), Expect = 3e-19 Identities = 52/54 (96%), Positives = 52/54 (96%) Query: 223 tcgtaggtgtagatgttgatgttgcgaggntccgggtagaagcaggagcagatc 276 |||||||||||||||||||||||||| || |||||||||||||||||||||||| Sbjct: 79 tcgtaggtgtagatgttgatgttgcgcggctccgggtagaagcaggagcagatc 26 >gnl|UG|Mm.7165 mb97d12.y1 Mus musculus cDNA, 5' end /clone=IMAGE:337367 /clone_end=5' /gb=AI322295 /len=856 Length = 856 Score = 34.2 bits (17), Expect = 0.21 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 153 tctgagaggaaagcaca 169 ||||||||||||||||| Sbjct: 30 tctgagaggaaagcaca 46 >gnl|UG|Mm.30021 ue13d03.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1480229 /clone_end=3' /gb=AA986448 /gi=3168102 /len=579 Length = 579 Score = 32.2 bits (16), Expect = 0.82 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 260 agaagcaggagcagat 275 |||||||||||||||| Sbjct: 310 agaagcaggagcagat 295 >gnl|UG|Mm.23281 mn38c04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:540198 /clone_end=3' /gb=AI427134 /len=345 Length = 345 Score = 32.2 bits (16), Expect = 0.82 Identities = 18/19 (94%), Positives = 18/19 (94%) Query: 118 cagaagaaggcattgnatc 136 ||||||||||||||| ||| Sbjct: 54 cagaagaaggcattggatc 72 >gnl|UG|Mm.16469 Mouse N-myc gene /cds=(349,1737) /gb=X03919 /gi=53426 /len=2639 Length = 2639 Score = 32.2 bits (16), Expect = 0.82 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 253 tccgggtagaagcagg 268 |||||||||||||||| Sbjct: 441 tccgggtagaagcagg 426 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1620 Number of Sequences: 15275 Number of extensions: 1620 Number of successful extensions: 441 Number of sequences better than 10: 16 length of query: 276 length of database: 15836343 effective HSP length: 16 effective length of query: 260 effective length of database: 15591943 effective search space: 4053905180 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)