BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 068a10 (289 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.5518 C76628 Mus musculus cDNA, 3' end /clone=J0015B05... 34 0.22 gnl|UG|Mm.20473 Mus musculus class I MHC-restricted T cell asso... 34 0.22 gnl|UG|Mm.20027 mm02b04.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.22 gnl|UG|Mm.25202 vr47c10.s1 Mus musculus cDNA, 5' end /clone=IMA... 32 0.86 gnl|UG|Mm.26498 C79663 Mus musculus cDNA, 3' end /clone=J0070B0... 32 0.86 >gnl|UG|Mm.5518 C76628 Mus musculus cDNA, 3' end /clone=J0015B05 /clone_end=3' /gb=C76628 /gi=2516958 /len=295 Length = 295 Score = 34.2 bits (17), Expect = 0.22 Identities = 26/29 (89%), Positives = 26/29 (89%) Query: 39 acatatatgctgggaagacactcatacat 67 |||||||||| || || |||||||||||| Sbjct: 29 acatatatgcaggcaaaacactcatacat 1 >gnl|UG|Mm.20473 Mus musculus class I MHC-restricted T cell associated molecule (CRTAM) mRNA, complete cds /cds=(0,1166) /gb=AF001104 /gi=3930160 /len=1890 Length = 1890 Score = 34.2 bits (17), Expect = 0.22 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 229 atgtggctgccctggct 245 ||||||||||||||||| Sbjct: 1307 atgtggctgccctggct 1291 >gnl|UG|Mm.20027 mm02b04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:520303 /clone_end=3' /gb=AI324963 /len=437 Length = 437 Score = 34.2 bits (17), Expect = 0.22 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 56 acactcatacatataaaataa 76 ||||||||| ||||||||||| Sbjct: 44 acactcatatatataaaataa 24 >gnl|UG|Mm.25202 vr47c10.s1 Mus musculus cDNA, 5' end /clone=IMAGE:1123794 /clone_end=5' /gb=AA794655 /gi=2857610 /len=482 Length = 482 Score = 32.2 bits (16), Expect = 0.86 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 66 atataaaataagaaca 81 |||||||||||||||| Sbjct: 236 atataaaataagaaca 221 >gnl|UG|Mm.26498 C79663 Mus musculus cDNA, 3' end /clone=J0070B02 /clone_end=3' /gb=C79663 /gi=2519993 /len=540 Length = 540 Score = 32.2 bits (16), Expect = 0.86 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 257 attcctaaagaaaagt 272 |||||||||||||||| Sbjct: 459 attcctaaagaaaagt 474 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3216 Number of Sequences: 15275 Number of extensions: 3216 Number of successful extensions: 908 Number of sequences better than 10: 23 length of query: 289 length of database: 15836343 effective HSP length: 16 effective length of query: 273 effective length of database: 15591943 effective search space: 4256600439 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)