BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 065e09 (189 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.26504 Lactate dehydrogenase 1, A chain /cds=(198,1196... 84 2e-16 gnl|UG|Mm.3159 Phosphorylase kinase gamma /cds=(57,1223) /gb=J0... 38 0.009 gnl|UG|Mm.2296 Peptidyl arginine deiminase /cds=(7,2028) /gb=D1... 38 0.009 gnl|UG|Mm.29938 Mus musculus G-protein-like LRG-47 mRNA, comple... 38 0.009 gnl|UG|Mm.25437 C86671 Mus musculus cDNA, 3' end /clone=J0230H0... 38 0.009 >gnl|UG|Mm.26504 Lactate dehydrogenase 1, A chain /cds=(198,1196) /gb=U13687 /gi=538134 /len=1681 Length = 1681 Score = 83.8 bits (42), Expect = 2e-16 Identities = 45/46 (97%), Positives = 45/46 (97%) Query: 144 ttggcatgacacttgagtggttggttccatcatccatatgcagatc 189 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1663 ttggcatgacacttgggtggttggttccatcatccatatgcagatc 1618 Score = 30.2 bits (15), Expect = 2.1 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 115 cactgttcaaggttt 129 ||||||||||||||| Sbjct: 1681 cactgttcaaggttt 1667 >gnl|UG|Mm.3159 Phosphorylase kinase gamma /cds=(57,1223) /gb=J03293 /gi=200338 /len=2225 Length = 2225 Score = 38.2 bits (19), Expect = 0.009 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 1 gatctgatgccctcttctg 19 ||||||||||||||||||| Sbjct: 2163 gatctgatgccctcttctg 2181 >gnl|UG|Mm.2296 Peptidyl arginine deiminase /cds=(7,2028) /gb=D16580 /gi=391765 /len=4697 Length = 4697 Score = 38.2 bits (19), Expect = 0.009 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 1 gatctgatgccctcttctg 19 ||||||||||||||||||| Sbjct: 3636 gatctgatgccctcttctg 3618 >gnl|UG|Mm.29938 Mus musculus G-protein-like LRG-47 mRNA, complete cds /cds=(445,1674) /gb=U19119 /gi=633753 /len=2227 Length = 2227 Score = 38.2 bits (19), Expect = 0.009 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 1 gatctgatgccctcttctg 19 ||||||||||||||||||| Sbjct: 2042 gatctgatgccctcttctg 2060 >gnl|UG|Mm.25437 C86671 Mus musculus cDNA, 3' end /clone=J0230H08 /clone_end=3' /gb=C86671 /gi=2918628 /len=572 Length = 572 Score = 38.2 bits (19), Expect = 0.009 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 1 gatctgatgccctcttctg 19 ||||||||||||||||||| Sbjct: 72 gatctgatgccctcttctg 54 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1502 Number of Sequences: 15275 Number of extensions: 1502 Number of successful extensions: 531 Number of sequences better than 10: 93 length of query: 189 length of database: 15836343 effective HSP length: 16 effective length of query: 173 effective length of database: 15591943 effective search space: 2697406139 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 14 (28.2 bits)