BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 058e05 (384 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.4989 Murine tlm oncogene for tlm protein /cds=(0,953)... 115 1e-25 gnl|UG|Mm.5763 C78885 Mus musculus cDNA, 3' end /clone=J0056G12... 56 8e-08 gnl|UG|Mm.26877 AU044722 Mus musculus cDNA, 3' end /clone=J0924... 44 3e-04 gnl|UG|Mm.26358 AU023004 Mus musculus cDNA, 3' end /clone=J0423... 36 0.074 gnl|UG|Mm.25554 vx80b06.r1 Mus musculus cDNA, 5' end /clone=IMA... 34 0.29 >gnl|UG|Mm.4989 Murine tlm oncogene for tlm protein /cds=(0,953) /gb=X52634 /gi=53528 /len=1425 Length = 1425 Score = 115 bits (58), Expect = 1e-25 Identities = 112/130 (86%), Positives = 112/130 (86%) Query: 2 atcaaaaactcaggtgacaccagatgctgaagaggatgtggagaaagaggaacactcctc 61 |||||||| |||| || || |||||||||| ||||||||||||||||| | ||||||||| Sbjct: 806 atcaaaaattcagatggcaacagatgctgacgaggatgtggagaaagaaggacactcctc 747 Query: 62 cattgttggtgggattgcagactggtaaaaccattctggaaatcagtctggaggttcctc 121 ||||| ||||| ||||||| || ||| ||||| ||||||||||||| || ||||||| Sbjct: 746 cattgctggtgagattgcaagctagtacaaccactctggaaatcagtttgacagttcctc 687 Query: 122 agaaaattgg 131 |||||||||| Sbjct: 686 agaaaattgg 677 >gnl|UG|Mm.5763 C78885 Mus musculus cDNA, 3' end /clone=J0056G12 /clone_end=3' /gb=C78885 /gi=2519215 /len=597 Length = 597 Score = 56.0 bits (28), Expect = 8e-08 Identities = 56/64 (87%), Positives = 56/64 (87%), Gaps = 1/64 (1%) Query: 90 aaccattctggaaatcagtctgga-ggttcctcagaaaattggacattgaactgcctgag 148 ||||| ||||||||||||| ||| |||||||||||||||||||||| | ||| || ||| Sbjct: 481 aaccactctggaaatcagtatgggcggttcctcagaaaattggacatagtactaccggag 540 Query: 149 gatc 152 |||| Sbjct: 541 gatc 544 >gnl|UG|Mm.26877 AU044722 Mus musculus cDNA, 3' end /clone=J0924B10 /clone_end=3' /gb=AU044722 /gi=3980905 /len=569 Length = 569 Score = 44.1 bits (22), Expect = 3e-04 Identities = 25/26 (96%), Positives = 25/26 (96%) Query: 104 tcagtctggaggttcctcagaaaatt 129 ||||||||| |||||||||||||||| Sbjct: 543 tcagtctggcggttcctcagaaaatt 568 >gnl|UG|Mm.26358 AU023004 Mus musculus cDNA, 3' end /clone=J0423H09 /clone_end=3' /gb=AU023004 /gi=3393351 /len=546 Length = 546 Score = 36.2 bits (18), Expect = 0.074 Identities = 25/26 (96%), Positives = 25/26 (96%), Gaps = 1/26 (3%) Query: 37 atgtggagaaagaggaacactcctcc 62 ||||||||||||| |||||||||||| Sbjct: 430 atgtggagaaaga-gaacactcctcc 454 >gnl|UG|Mm.25554 vx80b06.r1 Mus musculus cDNA, 5' end /clone=IMAGE:1281491 /clone_end=5' /gb=AA874396 /gi=2979085 /len=436 Length = 436 Score = 34.2 bits (17), Expect = 0.29 Identities = 27/31 (87%), Positives = 27/31 (87%) Query: 300 acangcctgtaatccaancacttgggaagca 330 ||| ||||||||||| | ||| ||||||||| Sbjct: 297 acacgcctgtaatcccagcacatgggaagca 327 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2246 Number of Sequences: 15275 Number of extensions: 2246 Number of successful extensions: 663 Number of sequences better than 10: 25 length of query: 384 length of database: 15836343 effective HSP length: 16 effective length of query: 368 effective length of database: 15591943 effective search space: 5737835024 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)