BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 052g11 (668 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.14089 Mouse mRNA for cytochrome P1-450 (EC 1.14.14.1)... 34 0.52 gnl|UG|Mm.5076 Tolloid-like /cds=(610,3651) /gb=U34042 /gi=1421... 32 2.0 gnl|UG|Mm.1009 Mouse interleukin-4 receptor (secreted form) mRN... 32 2.0 gnl|UG|Mm.29279 Smoothened homolog (Drosophila) /cds=UNKNOWN /g... 32 2.0 >gnl|UG|Mm.14089 Mouse mRNA for cytochrome P1-450 (EC 1.14.14.1) (with benzo[a]pyrene-resistant mutants c1 and c37) /cds=(101,1675) /gb=Y00071 /gi=50625 /len=2619 Length = 2619 Score = 34.2 bits (17), Expect = 0.52 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 19 tcctcagcatcttcagg 35 ||||||||||||||||| Sbjct: 1655 tcctcagcatcttcagg 1671 >gnl|UG|Mm.5076 Tolloid-like /cds=(610,3651) /gb=U34042 /gi=1421725 /len=4754 Length = 4754 Score = 32.2 bits (16), Expect = 2.0 Identities = 22/24 (91%), Positives = 22/24 (91%) Query: 111 cacacacagactcacacacttgca 134 |||||||| || |||||||||||| Sbjct: 4166 cacacacacacacacacacttgca 4143 >gnl|UG|Mm.1009 Mouse interleukin-4 receptor (secreted form) mRNA, complete cds /cds=(236,928) /gb=M27960 /gi=198365 /len=3697 Length = 3697 Score = 32.2 bits (16), Expect = 2.0 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 143 tcctgatgtcagggctctac 162 |||||||||||||| ||||| Sbjct: 808 tcctgatgtcaggggtctac 827 >gnl|UG|Mm.29279 Smoothened homolog (Drosophila) /cds=UNKNOWN /gb=AF089721 /gi=3608491 /len=1073 Length = 1073 Score = 32.2 bits (16), Expect = 2.0 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 110 gcacacacagactcacacac 129 |||||||||||| ||||||| Sbjct: 653 gcacacacagacacacacac 672 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3493 Number of Sequences: 15275 Number of extensions: 3493 Number of successful extensions: 296 Number of sequences better than 10: 5 length of query: 668 length of database: 15836343 effective HSP length: 17 effective length of query: 651 effective length of database: 15576668 effective search space: 10140410868 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)