BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 02725 (656 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.23924 ud54c03.r1 Mus musculus cDNA, 5' end /clone=IMA... 56 1e-07 gnl|UG|Mm.27948 C79210 Mus musculus cDNA, 3' end /clone=J0062E0... 56 1e-07 gnl|UG|Mm.26764 ui76d02.x1 Mus musculus cDNA, 3' end /clone=IMA... 54 5e-07 gnl|UG|Mm.24845 vs14e11.r1 Mus musculus cDNA, 5' end /clone=IMA... 54 5e-07 gnl|UG|Mm.30077 vi39g02.r1 Mus musculus cDNA, 5' end /clone=IMA... 48 3e-05 >gnl|UG|Mm.23924 ud54c03.r1 Mus musculus cDNA, 5' end /clone=IMAGE:1449700 /clone_end=5' /gb=AI152959 /gi=3681428 /len=497 Length = 497 Score = 56.0 bits (28), Expect = 1e-07 Identities = 31/32 (96%), Positives = 31/32 (96%) Query: 477 tgggaatcaaacctgggtcctctgcaagagca 508 ||||||||||||||||||| |||||||||||| Sbjct: 452 tgggaatcaaacctgggtcttctgcaagagca 483 >gnl|UG|Mm.27948 C79210 Mus musculus cDNA, 3' end /clone=J0062E02 /clone_end=3' /gb=C79210 /gi=2519540 /len=605 Length = 605 Score = 56.0 bits (28), Expect = 1e-07 Identities = 91/112 (81%), Positives = 91/112 (81%) Query: 433 ctggaattgcagttacagacagatggtaattgtcatgtgggtattgggaatcaaacctgg 492 |||||| || |||||||||||| || || || ||||||||| |||||| |||| || Sbjct: 79 ctggaactgaagttacagacagttgtgaactgccatgtgggtgctgggaactgaaccagg 138 Query: 493 gtcctctgcaagagcagctaatgctcttatctgctaagccatctctccagct 544 |||||||| ||||||||| | || ||||| | || |||||||||||||||| Sbjct: 139 gtcctctggaagagcagccagtgttcttaacctctgagccatctctccagct 190 >gnl|UG|Mm.26764 ui76d02.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1888323 /clone_end=3' /gb=AI256003 /gi=3863528 /len=905 Length = 905 Score = 54.0 bits (27), Expect = 5e-07 Identities = 48/55 (87%), Positives = 48/55 (87%) Query: 486 aacctgggtcctctgcaagagcagctaatgctcttatctgctaagccatctctcc 540 |||||||||| |||||||||||||| | |||||||| ||||| ||| | |||||| Sbjct: 286 aacctgggtcttctgcaagagcagccagtgctcttaactgcttagctacctctcc 340 >gnl|UG|Mm.24845 vs14e11.r1 Mus musculus cDNA, 5' end /clone=IMAGE:1138220 /clone_end=5' /gb=AA691310 /gi=2692246 /len=342 Length = 342 Score = 54.0 bits (27), Expect = 5e-07 Identities = 57/67 (85%), Positives = 57/67 (85%) Query: 477 tgggaatcaaacctgggtcctctgcaagagcagctaatgctcttatctgctaagccatct 536 ||||||||||||| ||| |||||| ||||||||| | |||||||| | || ||||| || Sbjct: 175 tgggaatcaaacccggggcctctggaagagcagccagtgctcttaaccactgagccagct 116 Query: 537 ctccagc 543 ||||||| Sbjct: 115 ctccagc 109 >gnl|UG|Mm.30077 vi39g02.r1 Mus musculus cDNA, 5' end /clone=IMAGE:906194 /clone_end=5' /gb=AA529389 /gi=2272095 /len=533 Length = 533 Score = 48.1 bits (24), Expect = 3e-05 Identities = 60/72 (83%), Positives = 60/72 (83%) Query: 477 tgggaatcaaacctgggtcctctgcaagagcagctaatgctcttatctgctaagccatct 536 ||||||| ||||||||||||||| |||||||| | |||||||| | ||||||||| Sbjct: 421 tgggaattgaacctgggtcctctgagagagcagccagtgctcttaaccttcaagccatct 362 Query: 537 ctccagctccag 548 ||||||| |||| Sbjct: 361 ctccagccccag 350 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3658 Number of Sequences: 15275 Number of extensions: 3658 Number of successful extensions: 430 Number of sequences better than 10: 93 length of query: 656 length of database: 15836343 effective HSP length: 17 effective length of query: 639 effective length of database: 15576668 effective search space: 9953490852 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)