BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 02146 (461 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.8149 Male germ cell-associated kinase /cds=(222,2090)... 86 1e-16 gnl|UG|Mm.1104 Ubiquitin-activating enzyme E1, Chr X /cds=(91,3... 34 0.35 gnl|UG|Mm.21840 mi20b02.r1 Mus musculus cDNA, 5' end /clone=IMA... 32 1.4 gnl|UG|Mm.25653 ub59h03.s1 Mus musculus cDNA, 3' end /clone=IMA... 32 1.4 gnl|UG|Mm.27179 C79562 Mus musculus cDNA, 3' end /clone=J0068B0... 32 1.4 >gnl|UG|Mm.8149 Male germ cell-associated kinase /cds=(222,2090) /gb=X66983 /gi=53913 /len=2188 Length = 2188 Score = 85.7 bits (43), Expect = 1e-16 Identities = 61/67 (91%), Positives = 61/67 (91%) Query: 13 tttcttgagaaaggaaggcacgcatcccgtctggctgtaagcgctgtagctcccaaggtt 72 |||||||||||||||||||| | ||||||||||| |||||| | |||||||||||||||| Sbjct: 1878 tttcttgagaaaggaaggcatgtatcccgtctggttgtaagtggtgtagctcccaaggtt 1819 Query: 73 ccctgct 79 |||||| Sbjct: 1818 tcctgct 1812 >gnl|UG|Mm.1104 Ubiquitin-activating enzyme E1, Chr X /cds=(91,3267) /gb=D10576 /gi=220628 /len=3458 Length = 3458 Score = 34.2 bits (17), Expect = 0.35 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 433 ccttgccagcatcactg 449 ||||||||||||||||| Sbjct: 1005 ccttgccagcatcactg 1021 >gnl|UG|Mm.21840 mi20b02.r1 Mus musculus cDNA, 5' end /clone=IMAGE:464043 /clone_end=5' /gb=AA028398 /gi=1494628 /len=960 Length = 960 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 417 ttgctctcagcctcag 432 |||||||||||||||| Sbjct: 452 ttgctctcagcctcag 437 >gnl|UG|Mm.25653 ub59h03.s1 Mus musculus cDNA, 3' end /clone=IMAGE:1382069 /clone_end=3' /gb=AA958975 /gi=3125205 /len=398 Length = 398 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 212 ctcactcagtccctgc 227 |||||||||||||||| Sbjct: 273 ctcactcagtccctgc 258 >gnl|UG|Mm.27179 C79562 Mus musculus cDNA, 3' end /clone=J0068B07 /clone_end=3' /gb=C79562 /gi=2519892 /len=563 Length = 563 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 224 ctgcacagcccagagg 239 |||||||||||||||| Sbjct: 92 ctgcacagcccagagg 77 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3993 Number of Sequences: 15275 Number of extensions: 3993 Number of successful extensions: 1099 Number of sequences better than 10: 7 length of query: 461 length of database: 15836343 effective HSP length: 17 effective length of query: 444 effective length of database: 15576668 effective search space: 6916040592 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)