BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 01241 (286 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.25058 C80007 Mus musculus cDNA, 3' end /clone=J0075B0... 76 6e-14 gnl|UG|Mm.23417 mn90g08.x1 Mus musculus cDNA, 3' end /clone=IMA... 62 9e-10 gnl|UG|Mm.29191 mt65c09.x1 Mus musculus cDNA, 3' end /clone=IMA... 62 9e-10 gnl|UG|Mm.25447 C86753 Mus musculus cDNA, 3' end /clone=J0232D0... 56 6e-08 gnl|UG|Mm.3528 Sulfonylurea receptor 2 /cds=(161,4801) /gb=D860... 54 2e-07 >gnl|UG|Mm.25058 C80007 Mus musculus cDNA, 3' end /clone=J0075B08 /clone_end=3' /gb=C80007 /gi=2520337 /len=570 Length = 570 Score = 75.8 bits (38), Expect = 6e-14 Identities = 59/66 (89%), Positives = 59/66 (89%) Query: 221 acttgacacaagctggagatatcacagataaaggagcctcccctgaggaaatgactctct 280 |||||||||||||||||| ||||||| | ||||||||||||| |||||||||| ||| | Sbjct: 221 acttgacacaagctggagttatcacacagaaaggagcctcccttgaggaaatgcctccat 280 Query: 281 gagatc 286 |||||| Sbjct: 281 gagatc 286 >gnl|UG|Mm.23417 mn90g08.x1 Mus musculus cDNA, 3' end /clone=IMAGE:551390 /clone_end=3' /gb=AI428270 /len=430 Length = 430 Score = 61.9 bits (31), Expect = 9e-10 Identities = 46/51 (90%), Positives = 46/51 (90%) Query: 2 atccacctgcctcagactcccaagtgctggaattaaagccctgtgccacca 52 |||||||||||| | |||||||||||||||||||||| | |||||||||| Sbjct: 97 atccacctgcctttgtctcccaagtgctggaattaaaggcttgtgccacca 147 >gnl|UG|Mm.29191 mt65c09.x1 Mus musculus cDNA, 3' end /clone=IMAGE:634768 /clone_end=3' /gb=AI326149 /len=556 Length = 556 Score = 61.9 bits (31), Expect = 9e-10 Identities = 46/51 (90%), Positives = 46/51 (90%) Query: 2 atccacctgcctcagactcccaagtgctggaattaaagccctgtgccacca 52 ||||||||||||| | |||||||||||||| ||||||| | |||||||||| Sbjct: 84 atccacctgcctctgcctcccaagtgctgggattaaaggcgtgtgccacca 134 >gnl|UG|Mm.25447 C86753 Mus musculus cDNA, 3' end /clone=J0232D07 /clone_end=3' /gb=C86753 /gi=2918710 /len=576 Length = 576 Score = 56.0 bits (28), Expect = 6e-08 Identities = 46/52 (88%), Positives = 46/52 (88%) Query: 1 gatccacctgcctcagactcccaagtgctggaattaaagccctgtgccacca 52 |||||||||||||| | ||||| |||||||||||||||| | || ||||||| Sbjct: 192 gatccacctgcctctgcctccctagtgctggaattaaaggcgtgcgccacca 141 >gnl|UG|Mm.3528 Sulfonylurea receptor 2 /cds=(161,4801) /gb=D86037 /gi=1655425 /len=6210 Length = 6210 Score = 54.0 bits (27), Expect = 2e-07 Identities = 45/51 (88%), Positives = 45/51 (88%) Query: 2 atccacctgcctcagactcccaagtgctggaattaaagccctgtgccacca 52 ||||||||||||| | |||||||||||||| ||||||| | || ||||||| Sbjct: 5367 atccacctgcctctgcctcccaagtgctgggattaaaggcgtgcgccacca 5417 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2580 Number of Sequences: 15275 Number of extensions: 2580 Number of successful extensions: 833 Number of sequences better than 10: 168 length of query: 286 length of database: 15836343 effective HSP length: 16 effective length of query: 270 effective length of database: 15591943 effective search space: 4209824610 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)