BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 00566 (408 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.28219 uc81g02.x1 Mus musculus cDNA, 3' end /clone=IMA... 94 4e-19 gnl|UG|Mm.9248 Poly (ADP-ribose) polymerase /cds=(84,3125) /gb=... 36 0.079 gnl|UG|Mm.4848 Mus musculus Fyn(T) (L-fyn(T)) mRNA, complete cd... 32 1.2 gnl|UG|Mm.4717 Laminin, gamma 2 /cds=(39,3617) /gb=U43327 /gi=1... 32 1.2 >gnl|UG|Mm.28219 uc81g02.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1432082 /clone_end=3' /gb=AA986104 /gi=3167979 /len=617 Length = 617 Score = 93.7 bits (47), Expect = 4e-19 Identities = 69/75 (92%), Positives = 69/75 (92%), Gaps = 1/75 (1%) Query: 3 tctttctcgtctctgcctggagtgaaaagta-cctggcatgtggtaactgcttaataaat 61 ||||||| |||||||||| ||||||||| || |||||||||||||| ||||||||||||| Sbjct: 85 tctttcttgtctctgcctagagtgaaaactagcctggcatgtggtagctgcttaataaat 26 Query: 62 attcatggaaagatg 76 |||||||| |||||| Sbjct: 25 attcatgggaagatg 11 >gnl|UG|Mm.9248 Poly (ADP-ribose) polymerase /cds=(84,3125) /gb=X14206 /gi=49893 /len=3172 Length = 3172 Score = 36.2 bits (18), Expect = 0.079 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 353 gtgatgctggccgaaggg 370 |||||||||||||||||| Sbjct: 2969 gtgatgctggccgaaggg 2952 >gnl|UG|Mm.4848 Mus musculus Fyn(T) (L-fyn(T)) mRNA, complete cds /cds=(226,1830) /gb=U70324 /gi=1575676 /len=3238 Length = 3238 Score = 32.2 bits (16), Expect = 1.2 Identities = 18/19 (94%), Positives = 18/19 (94%) Query: 201 tattattttccaaaantgg 219 ||||||||||||||| ||| Sbjct: 2216 tattattttccaaaagtgg 2234 >gnl|UG|Mm.4717 Laminin, gamma 2 /cds=(39,3617) /gb=U43327 /gi=1151216 /len=5145 Length = 5145 Score = 32.2 bits (16), Expect = 1.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 66 atggaaagatggatgg 81 |||||||||||||||| Sbjct: 4653 atggaaagatggatgg 4638 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2212 Number of Sequences: 15275 Number of extensions: 2212 Number of successful extensions: 580 Number of sequences better than 10: 13 length of query: 408 length of database: 15836343 effective HSP length: 16 effective length of query: 392 effective length of database: 15591943 effective search space: 6112041656 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)