BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D4Rat112 (486 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4... 44 4e-04 gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766) ... 44 4e-04 gnl|UG|Mm.2932 Mouse G protein-coupled receptor (EBI 1) mRNA, c... 38 0.024 gnl|UG|Mm.16813 vj87d01.r1 Mus musculus cDNA, 3' end /clone=IMA... 36 0.094 gnl|UG|Mm.20894 Mus musculus mRNA for p73H, complete cds /cds=(... 34 0.37 >gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4 (BMP-4) /cds=(356,1582) /gb=X56848 /gi=50180 /len=1785 Length = 1785 Score = 44.1 bits (22), Expect = 4e-04 Identities = 22/22 (100%), Positives = 22/22 (100%) Query: 1 aggtcgactctagaggatcccc 22 |||||||||||||||||||||| Sbjct: 1771 aggtcgactctagaggatcccc 1750 >gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766) /gb=D55720 /gi=893392 /len=2048 Length = 2048 Score = 44.1 bits (22), Expect = 4e-04 Identities = 22/22 (100%), Positives = 22/22 (100%) Query: 1 aggtcgactctagaggatcccc 22 |||||||||||||||||||||| Sbjct: 11 aggtcgactctagaggatcccc 32 >gnl|UG|Mm.2932 Mouse G protein-coupled receptor (EBI 1) mRNA, complete cds /cds=(175,1311) /gb=L31580 /gi=468340 /len=2072 Length = 2072 Score = 38.2 bits (19), Expect = 0.024 Identities = 22/23 (95%), Positives = 22/23 (95%) Query: 341 gaaacaaataaaacaaaaatttt 363 ||||||||||||| ||||||||| Sbjct: 2030 gaaacaaataaaaaaaaaatttt 2052 >gnl|UG|Mm.16813 vj87d01.r1 Mus musculus cDNA, 3' end /clone=IMAGE:944065 /clone_end=3' /gb=AA537062 /gi=2283055 /len=603 Length = 603 Score = 36.2 bits (18), Expect = 0.094 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 349 taaaacaaaaattttaaa 366 |||||||||||||||||| Sbjct: 602 taaaacaaaaattttaaa 585 >gnl|UG|Mm.20894 Mus musculus mRNA for p73H, complete cds /cds=(118,1878) /gb=AB010152 /gi=3445481 /len=4669 Length = 4669 Score = 34.2 bits (17), Expect = 0.37 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 342 aaacaaataaaacaaaa 358 ||||||||||||||||| Sbjct: 2719 aaacaaataaaacaaaa 2703 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3169 Number of Sequences: 15275 Number of extensions: 3169 Number of successful extensions: 946 Number of sequences better than 10: 13 length of query: 486 length of database: 15836343 effective HSP length: 17 effective length of query: 469 effective length of database: 15576668 effective search space: 7305457292 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)