BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 974e07 (362 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.117270 ny67c09.s1 Homo sapiens cDNA /clone=IMAGE:1283... 36 0.20 gnl|UG|Hs.131059 ot86d06.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.20 gnl|UG|Hs.2259 H.sapiens CD3G gene, exon 1 (and joined CDS) /cd... 34 0.78 gnl|UG|Hs.12797 Homo sapiens mRNA for KIAA0577 protein, complet... 34 0.78 >gnl|UG|Hs.117270 ny67c09.s1 Homo sapiens cDNA /clone=IMAGE:1283344 /gb=AA744729 /gi=2783493 /len=525 Length = 525 Score = 36.2 bits (18), Expect = 0.20 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 292 atgtattttaaaaaacttataa 313 ||||||||||||||| |||||| Sbjct: 31 atgtattttaaaaaaattataa 10 >gnl|UG|Hs.131059 ot86d06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1623659 /clone_end=3' /gb=AI016364 /gi=3230700 /len=478 Length = 478 Score = 36.2 bits (18), Expect = 0.20 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 288 aaaaatgtattttaaaaa 305 |||||||||||||||||| Sbjct: 74 aaaaatgtattttaaaaa 91 >gnl|UG|Hs.2259 H.sapiens CD3G gene, exon 1 (and joined CDS) /cds=(87,635) /gb=X06026 /gi=36809 /len=827 Length = 827 Score = 34.2 bits (17), Expect = 0.78 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 159 gtcctgagttcaattcc 175 ||||||||||||||||| Sbjct: 645 gtcctgagttcaattcc 629 >gnl|UG|Hs.12797 Homo sapiens mRNA for KIAA0577 protein, complete cds /cds=(1894,5019) /gb=AB011149 /gi=3043677 /len=5134 Length = 5134 Score = 34.2 bits (17), Expect = 0.78 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 297 ttttaaaaaacttataa 313 ||||||||||||||||| Sbjct: 250 ttttaaaaaacttataa 234 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 13934 Number of Sequences: 62236 Number of extensions: 13934 Number of successful extensions: 4032 Number of sequences better than 10: 48 length of query: 362 length of database: 45520635 effective HSP length: 17 effective length of query: 345 effective length of database: 44462623 effective search space: 15339604935 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)