BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 973d02 (402 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.75379 Human mRNA for glutamate transporter, complete ... 107 7e-23 gnl|UG|Hs.31227 yj07d09.s1 Homo sapiens cDNA, 3' end /clone=IMA... 38 0.056 gnl|UG|Hs.42500 tc02g10.x1 Homo sapiens cDNA /clone=IMAGE /gb=A... 34 0.87 gnl|UG|Hs.37110 Human MAGE-9 antigen (MAGE9) gene, complete cds... 34 0.87 >gnl|UG|Hs.75379 Human mRNA for glutamate transporter, complete cds /cds=(178,1806) /gb=D26443 /gi=472828 /len=3871 Length = 3871 Score = 107 bits (54), Expect = 7e-23 Identities = 57/58 (98%), Positives = 57/58 (98%) Query: 23 gtttcgttggcctggatgggcactttaaagcttctcttctcatagctggttttaaact 80 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 801 gtttcgttggcctggatgggcactttaaagcttctcttctcatagttggttttaaact 744 >gnl|UG|Hs.31227 yj07d09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:148049 /clone_end=3' /gb=H13642 /gi=878462 /len=421 Length = 421 Score = 38.2 bits (19), Expect = 0.056 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 337 aattacaataaagagggaa 355 ||||||||||||||||||| Sbjct: 34 aattacaataaagagggaa 16 >gnl|UG|Hs.42500 tc02g10.x1 Homo sapiens cDNA /clone=IMAGE /gb=AI344217 /len=822 Length = 822 Score = 34.2 bits (17), Expect = 0.87 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 116 ttatactttctctctgt 132 ||||||||||||||||| Sbjct: 85 ttatactttctctctgt 69 >gnl|UG|Hs.37110 Human MAGE-9 antigen (MAGE9) gene, complete cds /cds=(65,1012) /gb=U10694 /gi=533527 /len=1578 Length = 1578 Score = 34.2 bits (17), Expect = 0.87 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 58 cttctcatagctggttt 74 ||||||||||||||||| Sbjct: 917 cttctcatagctggttt 901 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 10449 Number of Sequences: 62236 Number of extensions: 10449 Number of successful extensions: 2907 Number of sequences better than 10: 29 length of query: 402 length of database: 45520635 effective HSP length: 17 effective length of query: 385 effective length of database: 44462623 effective search space: 17118109855 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)