BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 962f01 (312 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.140989 yh99c09.s1 Homo sapiens cDNA, 3' end /clone=IM... 42 0.003 gnl|UG|Hs.139361 zt86c01.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.67 gnl|UG|Hs.136937 ob43h10.s1 Homo sapiens cDNA /clone=IMAGE:1334... 34 0.67 >gnl|UG|Hs.140989 yh99c09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:137872 /clone_end=3' /gb=R68413 /gi=841930 /len=418 Length = 418 Score = 42.1 bits (21), Expect = 0.003 Identities = 36/41 (87%), Positives = 36/41 (87%) Query: 44 ctgccaaaagcattctacagattaaatacaatctccatcaa 84 |||||||||||| |||||| ||| ||| ||||| ||||||| Sbjct: 95 ctgccaaaagcaatctacaaattcaatgcaatccccatcaa 55 >gnl|UG|Hs.139361 zt86c01.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:729216 /clone_end=3' /gb=AA399660 /gi=2052674 /len=441 Length = 441 Score = 34.2 bits (17), Expect = 0.67 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 260 ttttataaatataaaca 276 ||||||||||||||||| Sbjct: 195 ttttataaatataaaca 211 >gnl|UG|Hs.136937 ob43h10.s1 Homo sapiens cDNA /clone=IMAGE:1334179 /gb=AA814977 /gi=2884573 /len=393 Length = 393 Score = 34.2 bits (17), Expect = 0.67 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 260 ttttataaatataaaca 276 ||||||||||||||||| Sbjct: 169 ttttataaatataaaca 185 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8194 Number of Sequences: 62236 Number of extensions: 8194 Number of successful extensions: 2299 Number of sequences better than 10: 16 length of query: 312 length of database: 45520635 effective HSP length: 17 effective length of query: 295 effective length of database: 44462623 effective search space: 13116473785 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)