BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 958h01 (408 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.26918 yz33b10.s1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.22 gnl|UG|Hs.28099 yc73h04.r1 Homo sapiens cDNA, 5' end /clone=IMA... 36 0.22 gnl|UG|Hs.8201 yi88f11.s1 Homo sapiens cDNA, 3' end /clone=IMAG... 36 0.22 >gnl|UG|Hs.26918 yz33b10.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:284827 /clone_end=3' /gb=N63325 /gi=1211154 /len=525 Length = 525 Score = 36.2 bits (18), Expect = 0.22 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 13 ttttctttcttcttaaaa 30 |||||||||||||||||| Sbjct: 97 ttttctttcttcttaaaa 114 >gnl|UG|Hs.28099 yc73h04.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:21749 /clone_end=5' /gb=T65525 /gi=674570 /len=529 Length = 529 Score = 36.2 bits (18), Expect = 0.22 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 13 ttttctttcttcttaaaa 30 |||||||||||||||||| Sbjct: 27 ttttctttcttcttaaaa 10 >gnl|UG|Hs.8201 yi88f11.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:146349 /clone_end=3' /gb=R79611 /gi=855892 /len=412 Length = 412 Score = 36.2 bits (18), Expect = 0.22 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 303 tggtgtcattggaaaatgtgga 324 |||||||||||||||| ||||| Sbjct: 117 tggtgtcattggaaaaggtgga 96 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 13472 Number of Sequences: 62236 Number of extensions: 13472 Number of successful extensions: 3248 Number of sequences better than 10: 31 length of query: 408 length of database: 45520635 effective HSP length: 17 effective length of query: 391 effective length of database: 44462623 effective search space: 17384885593 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)