BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 919c08 (394 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.125090 yv41f11.s1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.014 gnl|UG|Hs.97436 zx02a12.s1 Homo sapiens cDNA, 3' end /clone=IMA... 38 0.055 gnl|UG|Hs.14495 zx53e03.r1 Homo sapiens cDNA, 5' end /clone=IMA... 38 0.055 gnl|UG|Hs.136810 aa66c04.s1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.055 gnl|UG|Hs.139345 Homo sapiens apoptosis-related mRNA, 3'UTR, pa... 34 0.85 >gnl|UG|Hs.125090 yv41f11.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:245325 /clone_end=3' /gb=N53462 /gi=1194628 /len=608 Length = 608 Score = 40.1 bits (20), Expect = 0.014 Identities = 23/24 (95%), Positives = 23/24 (95%) Query: 268 gcacagggaaaccctgtctcaaaa 291 |||||| ||||||||||||||||| Sbjct: 126 gcacagtgaaaccctgtctcaaaa 103 >gnl|UG|Hs.97436 zx02a12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:785278 /clone_end=3' /gb=AA476418 /gi=2204629 /len=392 Length = 392 Score = 38.2 bits (19), Expect = 0.055 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 217 gagttcaaggccagcctgg 235 ||||||||||||||||||| Sbjct: 124 gagttcaaggccagcctgg 106 >gnl|UG|Hs.14495 zx53e03.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:446236 /clone_end=5' /gb=AA203491 /gi=1799464 /len=597 Length = 597 Score = 38.2 bits (19), Expect = 0.055 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 217 gagttcaaggccagcctgg 235 ||||||||||||||||||| Sbjct: 347 gagttcaaggccagcctgg 329 >gnl|UG|Hs.136810 aa66c04.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:825894 /clone_end=3' /gb=AA789098 /gi=2849218 /len=527 Length = 527 Score = 38.2 bits (19), Expect = 0.055 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 217 gagttcaaggccagcctgg 235 ||||||||||||||||||| Sbjct: 224 gagttcaaggccagcctgg 206 >gnl|UG|Hs.139345 Homo sapiens apoptosis-related mRNA, 3'UTR, partial sequence /cds=UNKNOWN /gb=AF035364 /gi=3064000 /len=1376 Length = 1376 Score = 34.2 bits (17), Expect = 0.85 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 217 gagttcaaggccagcctggtc 237 ||||||||| ||||||||||| Sbjct: 1202 gagttcaagaccagcctggtc 1222 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12663 Number of Sequences: 62236 Number of extensions: 12663 Number of successful extensions: 4493 Number of sequences better than 10: 86 length of query: 394 length of database: 45520635 effective HSP length: 17 effective length of query: 377 effective length of database: 44462623 effective search space: 16762408871 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)