BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 915e04 (197 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.27923 qh92f07.x1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.41 gnl|UG|Hs.104469 zb15d05.r1 Homo sapiens cDNA, 5' end /clone=IM... 34 0.41 gnl|UG|Hs.138898 zj96f06.s1 Homo sapiens cDNA, 3' end /clone=46... 34 0.41 gnl|UG|Hs.162143 ng36d05.s1 Homo sapiens cDNA, 3' end /clone=IM... 32 1.6 >gnl|UG|Hs.27923 qh92f07.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1854469 /clone_end=3' /gb=AI243475 /gi=3838872 /len=430 Length = 430 Score = 34.2 bits (17), Expect = 0.41 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 13 gagtttgaggccagtct 29 ||||||||||||||||| Sbjct: 48 gagtttgaggccagtct 32 >gnl|UG|Hs.104469 zb15d05.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:302121 /clone_end=5' /gb=W38395 /gi=1320060 /len=448 Length = 448 Score = 34.2 bits (17), Expect = 0.41 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 19 gaggccagtctagtcta 35 ||||||||||||||||| Sbjct: 173 gaggccagtctagtcta 189 >gnl|UG|Hs.138898 zj96f06.s1 Homo sapiens cDNA, 3' end /clone=462755 /clone_end=3' /gb=AA705207 /len=657 Length = 657 Score = 34.2 bits (17), Expect = 0.41 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 13 gagtttgaggccagtct 29 ||||||||||||||||| Sbjct: 45 gagtttgaggccagtct 29 >gnl|UG|Hs.162143 ng36d05.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:936873 /clone_end=3' /gb=AA527337 /gi=2269406 /len=525 Length = 525 Score = 32.2 bits (16), Expect = 1.6 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 136 cataaatttgtgagactgga 155 |||||| ||||||||||||| Sbjct: 412 cataaacttgtgagactgga 393 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2774 Number of Sequences: 62236 Number of extensions: 2774 Number of successful extensions: 739 Number of sequences better than 10: 4 length of query: 197 length of database: 45520635 effective HSP length: 17 effective length of query: 180 effective length of database: 44462623 effective search space: 8003272140 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)