BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 848g11 (385 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.146871 qc94e05.x1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.014 gnl|UG|Hs.5509 Human EVI2B3P gene, exon and complete cds /cds=(... 38 0.053 gnl|UG|Hs.112854 ai64c01.s1 Homo sapiens cDNA, 3' end /clone=13... 36 0.21 gnl|UG|Hs.134544 oz01b09.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.21 gnl|UG|Hs.52794 zc49f12.r1 Homo sapiens cDNA, 5' end /clone=IMA... 36 0.21 >gnl|UG|Hs.146871 qc94e05.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1721888 /clone_end=3' /gb=AI159988 /gi=3693368 /len=474 Length = 474 Score = 40.1 bits (20), Expect = 0.014 Identities = 32/36 (88%), Positives = 32/36 (88%) Query: 282 ttgcacatgctggccaagcactctaccactgagcta 317 ||||||||||| |||||||||||||||| ||||| Sbjct: 348 ttgcacatgctaagcaagcactctaccactcagcta 313 >gnl|UG|Hs.5509 Human EVI2B3P gene, exon and complete cds /cds=(21,1367) /gb=M60830 /gi=182282 /len=2078 Length = 2078 Score = 38.2 bits (19), Expect = 0.053 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 4 gatcccttctagaaaacaa 22 ||||||||||||||||||| Sbjct: 483 gatcccttctagaaaacaa 501 >gnl|UG|Hs.112854 ai64c01.s1 Homo sapiens cDNA, 3' end /clone=1375584 /clone_end=3' /gb=AA815244 /gi=2884840 /len=508 Length = 508 Score = 36.2 bits (18), Expect = 0.21 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 83 acagaatggaatttcaag 100 |||||||||||||||||| Sbjct: 117 acagaatggaatttcaag 100 >gnl|UG|Hs.134544 oz01b09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1674041 /clone_end=3' /gb=AI076822 /gi=3404651 /len=522 Length = 522 Score = 36.2 bits (18), Expect = 0.21 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 188 ctttcccatgtctttaaa 205 |||||||||||||||||| Sbjct: 513 ctttcccatgtctttaaa 496 >gnl|UG|Hs.52794 zc49f12.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:325679 /clone_end=5' /gb=W51887 /gi=1349709 /len=689 Length = 689 Score = 36.2 bits (18), Expect = 0.21 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 104 taatacattgaagcaggttcct 125 ||||||| |||||||||||||| Sbjct: 460 taatacagtgaagcaggttcct 439 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 9565 Number of Sequences: 62236 Number of extensions: 9565 Number of successful extensions: 2730 Number of sequences better than 10: 20 length of query: 385 length of database: 45520635 effective HSP length: 17 effective length of query: 368 effective length of database: 44462623 effective search space: 16362245264 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)