BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 840c05 (402 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.15519 Homo sapiens mRNA for KIAA0772 protein, complet... 36 0.22 gnl|UG|Hs.99442 om62a01.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.87 gnl|UG|Hs.110820 56g2 Homo sapiens cDNA /gb=W29065 /gi=1309094 ... 32 3.4 gnl|UG|Hs.161445 tg50b01.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 3.4 gnl|UG|Hs.75813 Polycystic kidney disease 1 (autosomal dominant... 32 3.4 >gnl|UG|Hs.15519 Homo sapiens mRNA for KIAA0772 protein, complete cds /cds=(147,1553) /gb=AB018315 /gi=3882264 /len=3879 Length = 3879 Score = 36.2 bits (18), Expect = 0.22 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 331 gtggtcacctctcctctc 348 |||||||||||||||||| Sbjct: 1089 gtggtcacctctcctctc 1072 >gnl|UG|Hs.99442 om62a01.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1551720 /clone_end=3' /gb=AA922659 /gi=3069968 /len=427 Length = 427 Score = 34.2 bits (17), Expect = 0.87 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 260 tgtcaacagcatgttcc 276 ||||||||||||||||| Sbjct: 169 tgtcaacagcatgttcc 153 >gnl|UG|Hs.110820 56g2 Homo sapiens cDNA /gb=W29065 /gi=1309094 /len=916 Length = 916 Score = 32.2 bits (16), Expect = 3.4 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 275 ccagctcctgtgaggagaaa 294 |||||||||||| ||||||| Sbjct: 86 ccagctcctgtgtggagaaa 67 >gnl|UG|Hs.161445 tg50b01.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2112169 /clone_end=3' /gb=AI424999 /len=533 Length = 533 Score = 32.2 bits (16), Expect = 3.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 310 cccattccagacacag 325 |||||||||||||||| Sbjct: 58 cccattccagacacag 43 >gnl|UG|Hs.75813 Polycystic kidney disease 1 (autosomal dominant) /cds=(211,13119) /gb=L33243 /gi=904222 /len=14136 Length = 14136 Score = 32.2 bits (16), Expect = 3.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 312 cattccagacacaggc 327 |||||||||||||||| Sbjct: 8766 cattccagacacaggc 8781 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8899 Number of Sequences: 62236 Number of extensions: 8899 Number of successful extensions: 2482 Number of sequences better than 10: 13 length of query: 402 length of database: 45520635 effective HSP length: 17 effective length of query: 385 effective length of database: 44462623 effective search space: 17118109855 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)