BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 776b05 (387 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.141589 yi31h10.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.21 gnl|UG|Hs.134488 zi70h02.s1 Homo sapiens cDNA, 3' end /clone=43... 36 0.21 gnl|UG|Hs.155113 ob60b01.s1 Homo sapiens cDNA /clone=IMAGE:1335... 34 0.84 gnl|UG|Hs.125402 of83a07.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.84 >gnl|UG|Hs.141589 yi31h10.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:140899 /clone_end=3' /gb=R67253 /gi=839891 /len=398 Length = 398 Score = 36.2 bits (18), Expect = 0.21 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 155 agttcaagactaccctgg 172 |||||||||||||||||| Sbjct: 175 agttcaagactaccctgg 192 >gnl|UG|Hs.134488 zi70h02.s1 Homo sapiens cDNA, 3' end /clone=436179 /clone_end=3' /gb=AA703271 /len=534 Length = 534 Score = 36.2 bits (18), Expect = 0.21 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 42 ataaatgaataaatcaat 59 |||||||||||||||||| Sbjct: 237 ataaatgaataaatcaat 254 >gnl|UG|Hs.155113 ob60b01.s1 Homo sapiens cDNA /clone=IMAGE:1335721 /gb=AA828280 /len=465 Length = 465 Score = 34.2 bits (17), Expect = 0.84 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 107 cacacctttaatctcaggact 127 ||||||| ||||||||||||| Sbjct: 340 cacacctgtaatctcaggact 320 >gnl|UG|Hs.125402 of83a07.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1436916 /clone_end=3' /gb=AA878811 /gi=2987776 /len=289 Length = 289 Score = 34.2 bits (17), Expect = 0.84 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 107 cacacctttaatctcag 123 ||||||||||||||||| Sbjct: 27 cacacctttaatctcag 43 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8902 Number of Sequences: 62236 Number of extensions: 8902 Number of successful extensions: 2425 Number of sequences better than 10: 16 length of query: 387 length of database: 45520635 effective HSP length: 17 effective length of query: 370 effective length of database: 44462623 effective search space: 16451170510 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)