BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 718b03 (254 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.110647 Meis1 (mouse) homolog /cds=(65,1237) /gb=U8570... 40 0.009 gnl|UG|Hs.108211 yu15c08.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.54 gnl|UG|Hs.58488 Homo sapiens alpha-catenin-like protein mRNA, c... 32 2.1 gnl|UG|Hs.74002 Homo sapiens mRNA for steroid receptor coactiva... 32 2.1 >gnl|UG|Hs.110647 Meis1 (mouse) homolog /cds=(65,1237) /gb=U85707 /gi=2058550 /len=2511 Length = 2511 Score = 40.1 bits (20), Expect = 0.009 Identities = 32/36 (88%), Positives = 32/36 (88%) Query: 17 agatgaaaccttagcacttgtattgcttgtatcatc 52 ||||||||||||| |||||||| ||||| |||||| Sbjct: 532 agatgaaaccttaatacttgtatggcttgaatcatc 497 >gnl|UG|Hs.108211 yu15c08.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:233870 /clone_end=3' /gb=H68077 /gi=1026817 /len=428 Length = 428 Score = 34.2 bits (17), Expect = 0.54 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 53 tgaaagggaaatttaag 69 ||||||||||||||||| Sbjct: 291 tgaaagggaaatttaag 307 >gnl|UG|Hs.58488 Homo sapiens alpha-catenin-like protein mRNA, complete cds /cds=(43,2247) /gb=U97067 /gi=3342777 /len=2446 Length = 2446 Score = 32.2 bits (16), Expect = 2.1 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 219 acatcaagaaataagg 234 |||||||||||||||| Sbjct: 548 acatcaagaaataagg 563 >gnl|UG|Hs.74002 Homo sapiens mRNA for steroid receptor coactivator 1e /cds=(201,4400) /gb=AJ000882 /gi=2924310 /len=4709 Length = 4709 Score = 32.2 bits (16), Expect = 2.1 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 201 tggtcaggcaaaaacc 216 |||||||||||||||| Sbjct: 3233 tggtcaggcaaaaacc 3248 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6696 Number of Sequences: 62236 Number of extensions: 6696 Number of successful extensions: 1886 Number of sequences better than 10: 16 length of query: 254 length of database: 45520635 effective HSP length: 17 effective length of query: 237 effective length of database: 44462623 effective search space: 10537641651 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)