BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 714b05 (350 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=44... 38 0.048 gnl|UG|Hs.29403 qv94e01.x1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.75 gnl|UG|Hs.144567 Alanine-glyoxylate aminotransferase (oxalosis ... 34 0.75 gnl|UG|Hs.98162 qf69b04.x1 Homo sapiens cDNA, 3' end /clone=IMA... 32 3.0 gnl|UG|Hs.8852 yd84a02.r1 Homo sapiens cDNA, 5' end /clone=IMAG... 32 3.0 >gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=449339 /clone_end=3' /gb=AA777920 /len=456 Length = 456 Score = 38.2 bits (19), Expect = 0.048 Identities = 31/35 (88%), Positives = 31/35 (88%) Query: 287 ttatatacatttcgagtgttattccctttcctggt 321 |||| |||||||| | |||||| |||||||||||| Sbjct: 32 ttatttacatttcaaatgttatcccctttcctggt 66 >gnl|UG|Hs.29403 qv94e01.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1989240 /clone_end=3' /gb=AI366887 /len=748 Length = 748 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 279 agtatttcttatataca 295 ||||||||||||||||| Sbjct: 586 agtatttcttatataca 570 >gnl|UG|Hs.144567 Alanine-glyoxylate aminotransferase (oxalosis I; hyperoxaluria I; glycolicaciduria; serine-pyruvate aminotransferase) /cds=UNKNOWN /gb=X53414 /gi=28560 /len=1600 Length = 1600 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 30 gtgtgatggtacatcct 46 ||||||||||||||||| Sbjct: 910 gtgtgatggtacatcct 894 >gnl|UG|Hs.98162 qf69b04.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1755247 /clone_end=3' /gb=AI201024 /gi=3753630 /len=451 Length = 451 Score = 32.2 bits (16), Expect = 3.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 73 ctcaggacatgaacat 88 |||||||||||||||| Sbjct: 73 ctcaggacatgaacat 88 >gnl|UG|Hs.8852 yd84a02.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:114890 /clone_end=5' /gb=T86213 /gi=714565 /len=476 Length = 476 Score = 32.2 bits (16), Expect = 3.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 109 gcacatgcatgcacgc 124 |||||||||||||||| Sbjct: 210 gcacatgcatgcacgc 195 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6018 Number of Sequences: 62236 Number of extensions: 6018 Number of successful extensions: 1578 Number of sequences better than 10: 11 length of query: 350 length of database: 45520635 effective HSP length: 17 effective length of query: 333 effective length of database: 44462623 effective search space: 14806053459 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)