BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 705f05 (233 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.49077 yz31f02.s1 Homo sapiens cDNA, 3' end /clone=IMA... 40 0.008 gnl|UG|Hs.105676 ab12h12.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.12 gnl|UG|Hs.22290 yg04f05.s1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.12 gnl|UG|Hs.28714 ok20d02.s1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.12 gnl|UG|Hs.129908 Homo sapiens mRNA for KIAA0591 protein, partia... 32 1.9 >gnl|UG|Hs.49077 yz31f02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:284667 /clone_end=3' /gb=N64824 /gi=1212653 /len=558 Length = 558 Score = 40.1 bits (20), Expect = 0.008 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 52 catccagattttccagtttt 71 |||||||||||||||||||| Sbjct: 376 catccagattttccagtttt 395 >gnl|UG|Hs.105676 ab12h12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:840647 /clone_end=3' /gb=AA487987 /gi=2215418 /len=307 Length = 307 Score = 36.2 bits (18), Expect = 0.12 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 166 tttcacctttctcactgg 183 |||||||||||||||||| Sbjct: 127 tttcacctttctcactgg 110 >gnl|UG|Hs.22290 yg04f05.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:31004 /clone_end=3' /gb=R41811 /gi=817515 /len=419 Length = 419 Score = 36.2 bits (18), Expect = 0.12 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 59 attttccagttttgttgaactt 80 |||||||||||||||| ||||| Sbjct: 71 attttccagttttgttcaactt 92 >gnl|UG|Hs.28714 ok20d02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1508355 /clone_end=3' /gb=AA947302 /gi=3108555 /len=473 Length = 473 Score = 36.2 bits (18), Expect = 0.12 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 166 tttcacctttctcactgg 183 |||||||||||||||||| Sbjct: 79 tttcacctttctcactgg 96 >gnl|UG|Hs.129908 Homo sapiens mRNA for KIAA0591 protein, partial cds /cds=(0,4017) /gb=AB011163 /gi=3043705 /len=5368 Length = 5368 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 167 ttcacctttctcactg 182 |||||||||||||||| Sbjct: 1570 ttcacctttctcactg 1555 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5609 Number of Sequences: 62236 Number of extensions: 5609 Number of successful extensions: 1667 Number of sequences better than 10: 9 length of query: 233 length of database: 45520635 effective HSP length: 17 effective length of query: 216 effective length of database: 44462623 effective search space: 9603926568 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)