BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 393g06 (279 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.142696 ye55b09.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.59 gnl|UG|Hs.146880 qb50c02.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 2.3 gnl|UG|Hs.61082 zt75f06.s1 Homo sapiens cDNA, 3' end /clone=IMA... 32 2.3 >gnl|UG|Hs.142696 ye55b09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:121625 /clone_end=3' /gb=T97641 /gi=746986 /len=431 Length = 431 Score = 34.2 bits (17), Expect = 0.59 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 75 gaacaaaaatattcaca 91 ||||||||||||||||| Sbjct: 255 gaacaaaaatattcaca 271 >gnl|UG|Hs.146880 qb50c02.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1703522 /clone_end=3' /gb=AI160226 /gi=3693606 /len=368 Length = 368 Score = 32.2 bits (16), Expect = 2.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 67 aaaagggggaacaaaa 82 |||||||||||||||| Sbjct: 84 aaaagggggaacaaaa 99 >gnl|UG|Hs.61082 zt75f06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:728195 /clone_end=3' /gb=AA398740 /gi=2051862 /len=471 Length = 471 Score = 32.2 bits (16), Expect = 2.3 Identities = 22/24 (91%), Positives = 22/24 (91%) Query: 119 gcagagactgaaagaacagccatt 142 ||||||| |||| ||||||||||| Sbjct: 348 gcagagattgaaggaacagccatt 325 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6420 Number of Sequences: 62236 Number of extensions: 6420 Number of successful extensions: 1762 Number of sequences better than 10: 11 length of query: 279 length of database: 45520635 effective HSP length: 17 effective length of query: 262 effective length of database: 44462623 effective search space: 11649207226 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)