BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 344a09 (396 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.328 Protein tyrosine phosphatase /cds=(41,3397) /gb=D... 70 2e-11 gnl|UG|Hs.150131 qo24a06.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.22 gnl|UG|Hs.137592 Homo sapiens DNA sequence from PAC 97D16 on ch... 34 0.86 >gnl|UG|Hs.328 Protein tyrosine phosphatase /cds=(41,3397) /gb=D15049 /gi=475003 /len=3900 Length = 3900 Score = 69.9 bits (35), Expect = 2e-11 Identities = 84/99 (84%), Positives = 84/99 (84%), Gaps = 1/99 (1%) Query: 118 gtccagttctctgtcacctcctcactaaccagcgtcacctgcagctggccatgagtgcag 177 ||||||||||| |||| ||||||| ||||| || ||| |||| || ||||| |||||| Sbjct: 2923 gtccagttctccatcacttcctcacctaccagggttacccgcaggtgcccatgggtgcag 2864 Query: 178 ggctgagcatccag-ggccagtaatgctcacacttcacc 215 ||||| | ||||| |||||||||||||||||||||||| Sbjct: 2863 ggctgcgagtccagaggccagtaatgctcacacttcacc 2825 >gnl|UG|Hs.150131 qo24a06.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1909426 /clone_end=3' /gb=AI299961 /gi=3959307 /len=419 Length = 419 Score = 36.2 bits (18), Expect = 0.22 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 356 tgtgtgcatatgtatatg 373 |||||||||||||||||| Sbjct: 185 tgtgtgcatatgtatatg 168 >gnl|UG|Hs.137592 Homo sapiens DNA sequence from PAC 97D16 on chromosome 6p21.3-22.2. Contains an unknown pseudogene, a 60S Ribosomal protein L24 (L30) LIKE pseudogene and histone genes H2BFC (H2B/c), H4FFP (H4/f pseudogene), H2AFC (H2A/c), H3F1K (H3.1/k) and a tRNA-Val pseudogene and tRNA-Thr gene. Contains ESTs, STSs, GSSs and genomic marker D6S464 /cds=(11,403) /gb=AL009179 /gi=3217024 /len=503 Length = 503 Score = 34.2 bits (17), Expect = 0.86 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 149 gcgtcacctgcagctggccat 169 ||||||||| ||||||||||| Sbjct: 254 gcgtcacctccagctggccat 274 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 11061 Number of Sequences: 62236 Number of extensions: 11061 Number of successful extensions: 2937 Number of sequences better than 10: 37 length of query: 396 length of database: 45520635 effective HSP length: 17 effective length of query: 379 effective length of database: 44462623 effective search space: 16851334117 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)