BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 067b04 (611 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.161 N-cadherin [human, umbilical vein endothelial cel... 40 0.022 gnl|UG|Hs.43242 yx65f07.s1 Homo sapiens cDNA, 3' end /clone=IMA... 38 0.086 gnl|UG|Hs.28285 Homo sapiens multiple membrane spanning recepto... 38 0.086 gnl|UG|Hs.128178 op86h08.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.34 gnl|UG|Hs.111710 qy22d01.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.34 >gnl|UG|Hs.161 N-cadherin [human, umbilical vein endothelial cells, mRNA, 4132 nt] /cds=(461,3178) /gb=S42303 /gi=253482 /len=4132 Length = 4132 Score = 40.1 bits (20), Expect = 0.022 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 310 ttttattttttattttcttt 329 |||||||||||||||||||| Sbjct: 4083 ttttattttttattttcttt 4102 >gnl|UG|Hs.43242 yx65f07.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:266629 /clone_end=3' /gb=N22765 /gi=1136915 /len=571 Length = 571 Score = 38.2 bits (19), Expect = 0.086 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 307 ctgttttattttttatttt 325 ||||||||||||||||||| Sbjct: 322 ctgttttattttttatttt 304 >gnl|UG|Hs.28285 Homo sapiens multiple membrane spanning receptor TRC8 (TRC8) mRNA, complete cds /cds=(237,2231) /gb=AF064801 /gi=3395786 /len=2486 Length = 2486 Score = 38.2 bits (19), Expect = 0.086 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 307 ctgttttattttttatttt 325 ||||||||||||||||||| Sbjct: 1220 ctgttttattttttatttt 1238 >gnl|UG|Hs.128178 op86h08.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1583775 /clone_end=3' /gb=AA972127 /gi=3147417 /len=371 Length = 371 Score = 36.2 bits (18), Expect = 0.34 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 370 ttttcctctcttagaaaatgta 391 ||||||||||||| |||||||| Sbjct: 112 ttttcctctcttaaaaaatgta 91 >gnl|UG|Hs.111710 qy22d01.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2012737 /clone_end=3' /gb=AI356701 /gi=4108322 /len=506 Length = 506 Score = 36.2 bits (18), Expect = 0.34 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 308 tgttttattttttatttt 325 |||||||||||||||||| Sbjct: 166 tgttttattttttatttt 149 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 18537 Number of Sequences: 62236 Number of extensions: 18537 Number of successful extensions: 1577 Number of sequences better than 10: 16 length of query: 611 length of database: 45520635 effective HSP length: 18 effective length of query: 593 effective length of database: 44400387 effective search space: 26329429491 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)