BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 02393 (505 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.128437 qm26g02.x1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.018 gnl|UG|Hs.156009 Human mRNA for KIAA0023 gene, complete cds /cd... 36 0.28 gnl|UG|Hs.162765 np21b10.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.28 gnl|UG|Hs.140562 oe59c08.s1 Homo sapiens cDNA /clone=IMAGE:1415... 34 1.1 >gnl|UG|Hs.128437 qm26g02.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1882994 /clone_end=3' /gb=AI279806 /gi=3918040 /len=555 Length = 555 Score = 40.1 bits (20), Expect = 0.018 Identities = 35/40 (87%), Positives = 35/40 (87%) Query: 329 attccattgtgtaaatgtactacattttctatatctattc 368 ||||||||||||| || ||| ||||||||| |||| |||| Sbjct: 450 attccattgtgtagatataccacattttctttatccattc 489 >gnl|UG|Hs.156009 Human mRNA for KIAA0023 gene, complete cds /cds=(55,6336) /gb=D14689 /gi=285956 /len=6642 Length = 6642 Score = 36.2 bits (18), Expect = 0.28 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 38 ttttgttcccccttctaa 55 |||||||||||||||||| Sbjct: 1618 ttttgttcccccttctaa 1635 >gnl|UG|Hs.162765 np21b10.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1116955 /clone_end=3' /gb=AA622535 /gi=2526411 /len=454 Length = 454 Score = 36.2 bits (18), Expect = 0.28 Identities = 33/38 (86%), Positives = 33/38 (86%) Query: 304 tcattgtttttgatagctgagtaaaattccattgtgta 341 ||||| ||||| |||||||| || ||||||||||||| Sbjct: 209 tcattcttttttatagctgaatactattccattgtgta 246 >gnl|UG|Hs.140562 oe59c08.s1 Homo sapiens cDNA /clone=IMAGE:1415918 /gb=AA826514 /len=419 Length = 419 Score = 34.2 bits (17), Expect = 1.1 Identities = 23/25 (92%), Positives = 23/25 (92%) Query: 333 cattgtgtaaatgtactacattttc 357 ||||||||| || |||||||||||| Sbjct: 133 cattgtgtatatatactacattttc 109 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12383 Number of Sequences: 62236 Number of extensions: 12383 Number of successful extensions: 3534 Number of sequences better than 10: 28 length of query: 505 length of database: 45520635 effective HSP length: 17 effective length of query: 488 effective length of database: 44462623 effective search space: 21697760024 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)