BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D7Rat76 (624 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,851 sequences; 45,673,593 total letters Searching.................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.138384 yj92h02.s1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.022 gnl|UG|Hs.1281 Complement component C5 /cds=(12,5042) /gb=M5772... 36 0.35 gnl|UG|Hs.154886 Chromosome 22q13 BAC Clone CIT987SK-384D8 comp... 34 1.4 gnl|UG|Hs.58751 oy85h06.x1 Homo sapiens cDNA, 3' end /clone=IMA... 34 1.4 >gnl|UG|Hs.138384 yj92h02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:156243 /clone_end=3' /gb=R72849 /gi=846881 /len=451 Length = 451 Score = 40.1 bits (20), Expect = 0.022 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 94 gtttattttggctcatggtt 113 |||||||||||||||||||| Sbjct: 15 gtttattttggctcatggtt 34 >gnl|UG|Hs.1281 Complement component C5 /cds=(12,5042) /gb=M57729 /gi=179982 /len=5444 Length = 5444 Score = 36.2 bits (18), Expect = 0.35 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 453 acagaccagataaacagt 470 |||||||||||||||||| Sbjct: 4508 acagaccagataaacagt 4525 >gnl|UG|Hs.154886 Chromosome 22q13 BAC Clone CIT987SK-384D8 complete sequence /cds=(0,1301) /gb=U62317 /gi=1399959 /len=1522 Length = 1522 Score = 34.2 bits (17), Expect = 1.4 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 73 cctgacagaggcaaagaaagg 93 |||| |||||||||||||||| Sbjct: 1062 cctggcagaggcaaagaaagg 1082 >gnl|UG|Hs.58751 oy85h06.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1672667 /clone_end=3' /gb=AI038283 /gi=3277477 /len=500 Length = 500 Score = 34.2 bits (17), Expect = 1.4 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 94 gtttattttggctcatg 110 ||||||||||||||||| Sbjct: 19 gtttattttggctcatg 35 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Mar 4, 1999 1:26 AM Number of letters in database: 45,673,593 Number of sequences in database: 62,851 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 11358 Number of Sequences: 62851 Number of extensions: 11358 Number of successful extensions: 906 Number of sequences better than 10: 5 length of query: 624 length of database: 45673593 effective HSP length: 18 effective length of query: 606 effective length of database: 44542275 effective search space: 26992618650 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)