BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D4Rat139 (644 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,851 sequences; 45,673,593 total letters Searching.................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.123014 Human anti-mullerian hormone type II receptor ... 60 2e-08 gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNK... 40 0.023 gnl|UG|Hs.1948 H.sapiens 8.2kDa differentiation factor mRNA /cd... 38 0.091 gnl|UG|Hs.136381 aa73h09.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.36 >gnl|UG|Hs.123014 Human anti-mullerian hormone type II receptor precursor gene, complete cds /cds=(78,1799) /gb=U29700 /gi=1136441 /len=1855 Length = 1855 Score = 60.0 bits (30), Expect = 2e-08 Identities = 59/69 (85%), Positives = 59/69 (85%) Query: 311 gagcggatgtttactctctggctctactactgtgggagatcctgagccgctgttccgatt 370 |||| ||| |||||||| ||||||| || ||||||||||| ||||||||||| | |||| Sbjct: 1298 gagctgatatttactctttggctctgctcctgtgggagatactgagccgctgcccagatt 1357 Query: 371 tgaggnctg 379 ||||| ||| Sbjct: 1358 tgaggcctg 1366 >gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNKNOWN /gb=X81636 /gi=704460 /len=2737 Length = 2737 Score = 40.1 bits (20), Expect = 0.023 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 1 caggtcgactctagaggatc 20 |||||||||||||||||||| Sbjct: 2718 caggtcgactctagaggatc 2737 >gnl|UG|Hs.1948 H.sapiens 8.2kDa differentiation factor mRNA /cds=(60,353) /gb=X79563 /gi=499069 /len=465 Length = 465 Score = 38.2 bits (19), Expect = 0.091 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 6 cgactctagaggatccccc 24 ||||||||||||||||||| Sbjct: 10 cgactctagaggatccccc 28 >gnl|UG|Hs.136381 aa73h09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:826625 /clone_end=3' /gb=AA521501 /gi=2262044 /len=693 Length = 693 Score = 36.2 bits (18), Expect = 0.36 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 347 agatcctgagccgctgttccg 367 |||||||| |||||||||||| Sbjct: 465 agatcctgngccgctgttccg 445 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Mar 4, 1999 1:26 AM Number of letters in database: 45,673,593 Number of sequences in database: 62,851 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 13472 Number of Sequences: 62851 Number of extensions: 13472 Number of successful extensions: 1898 Number of sequences better than 10: 16 length of query: 644 length of database: 45673593 effective HSP length: 18 effective length of query: 626 effective length of database: 44542275 effective search space: 27883464150 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)