BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 979b09 (343 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.31761 C06749 Rattus norvegicus cDNA /gb=C06749 /gi=15... 182 5e-46 gnl|UG|Rn.34332 EST221119 Rattus norvegicus cDNA, 3' end /clone... 76 8e-14 gnl|UG|Rn.30315 EST201331 Rattus norvegicus cDNA, 3' end /clone... 70 5e-12 gnl|UG|Rn.3550 EST197063 Rattus norvegicus cDNA, 3' end /clone=... 40 0.004 gnl|UG|Rn.29409 EST224115 Rattus norvegicus cDNA, 3' end /clone... 32 1.0 >gnl|UG|Rn.31761 C06749 Rattus norvegicus cDNA /gb=C06749 /gi=1503525 /len=489 Length = 489 Score = 182 bits (92), Expect = 5e-46 Identities = 101/104 (97%), Positives = 101/104 (97%) Query: 3 cgatctacatccggttcctgtcggcctgcacttctttgcttcatccatcttgtctaattg 62 |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 266 cgatctacatccggctcctgtcggtctgcacttctttgcttcatccatcttgtctaattg 207 Query: 63 ggtgactgtatatgtatgggccacatgtggggcaggctctgaat 106 |||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 206 ggtggctgtatatgtatgggccacatgtggggcaggctctgaat 163 >gnl|UG|Rn.34332 EST221119 Rattus norvegicus cDNA, 3' end /clone=RPLCA56 /clone_end=3' /gb=AI177487 /gi=3728125 /len=454 Length = 454 Score = 75.8 bits (38), Expect = 8e-14 Identities = 50/54 (92%), Positives = 50/54 (92%) Query: 53 tgtctaattgggtgactgtatatgtatgggccacatgtggggcaggctctgaat 106 |||| ||||||||| ||||| ||||||||||||| ||||||||||||||||||| Sbjct: 454 tgtccaattgggtggctgtaaatgtatgggccacctgtggggcaggctctgaat 401 >gnl|UG|Rn.30315 EST201331 Rattus norvegicus cDNA, 3' end /clone=RLUAU76 /clone_end=3' /gb=AA945832 /gi=3105748 /len=452 Length = 452 Score = 69.9 bits (35), Expect = 5e-12 Identities = 35/35 (100%), Positives = 35/35 (100%) Query: 4 gatctacatccggttcctgtcggcctgcacttctt 38 ||||||||||||||||||||||||||||||||||| Sbjct: 394 gatctacatccggttcctgtcggcctgcacttctt 428 >gnl|UG|Rn.3550 EST197063 Rattus norvegicus cDNA, 3' end /clone=RKIBE21 /clone_end=3' /gb=AA893260 /gi=3020139 /len=514 Length = 514 Score = 40.1 bits (20), Expect = 0.004 Identities = 29/32 (90%), Positives = 29/32 (90%) Query: 4 gatctacatccggttcctgtcggcctgcactt 35 ||||||||||| | ||||||||| |||||||| Sbjct: 273 gatctacatcctgctcctgtcggtctgcactt 242 >gnl|UG|Rn.29409 EST224115 Rattus norvegicus cDNA, 3' end /clone=RSPCV52 /clone_end=3' /gb=AI180371 /gi=3731009 /len=411 Length = 411 Score = 32.2 bits (16), Expect = 1.0 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 69 tgtatatgtatgggccacat 88 ||||||||||| |||||||| Sbjct: 281 tgtatatgtattggccacat 262 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2601 Number of Sequences: 23003 Number of extensions: 2601 Number of successful extensions: 665 Number of sequences better than 10: 19 length of query: 343 length of database: 15818664 effective HSP length: 16 effective length of query: 327 effective length of database: 15450616 effective search space: 5052351432 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)