BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 957c10 (382 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.32442 UI-R-E0-dd-d-09-0-UI.s1 Rattus norvegicus cDNA,... 204 1e-52 gnl|UG|Rn.33923 EST219758 Rattus norvegicus cDNA, 3' end /clone... 190 2e-48 gnl|UG|Rn.31142 EST221005 Rattus norvegicus cDNA, 3' end /clone... 190 2e-48 gnl|UG|Rn.32001 EST232262 Rattus norvegicus cDNA, 3' end /clone... 188 8e-48 gnl|UG|Rn.33246 EST208614 Rattus norvegicus cDNA, 3' end /clone... 184 1e-46 >gnl|UG|Rn.32442 UI-R-E0-dd-d-09-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E0-dd-d-09-0-UI /clone_end=3' /gb=AA900319 /gi=3035673 /len=539 Length = 539 Score = 204 bits (103), Expect = 1e-52 Identities = 103/103 (100%), Positives = 103/103 (100%) Query: 9 cattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacctctgga 68 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 93 cattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacctctgga 152 Query: 69 agagcagtcggtgctcttaaccactgagccatctctccagccc 111 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 153 agagcagtcggtgctcttaaccactgagccatctctccagccc 195 >gnl|UG|Rn.33923 EST219758 Rattus norvegicus cDNA, 3' end /clone=ROVBL85 /clone_end=3' /gb=AI176177 /gi=3726815 /len=487 Length = 487 Score = 190 bits (96), Expect = 2e-48 Identities = 105/108 (97%), Positives = 105/108 (97%) Query: 4 gatctcattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacct 63 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 144 gatctcattacagatggttgtgagccaccatgtggtcgctgggatttgaactcaggacct 85 Query: 64 ctggaagagcagtcggtgctcttaaccactgagccatctctccagccc 111 |||| ||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 84 ctggtagagcagtcagtgctcttaaccactgagccatctctccagccc 37 >gnl|UG|Rn.31142 EST221005 Rattus norvegicus cDNA, 3' end /clone=RPLBY44 /clone_end=3' /gb=AI177385 /gi=3728023 /len=576 Length = 576 Score = 190 bits (96), Expect = 2e-48 Identities = 105/108 (97%), Positives = 105/108 (97%) Query: 4 gatctcattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacct 63 |||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 36 gatcccattacggatggttgtgagccaccatgtggttgctgggaattgaactcaggacct 95 Query: 64 ctggaagagcagtcggtgctcttaaccactgagccatctctccagccc 111 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 96 ctggaagagcagtcggtgctcttaaccactgagccatctctccagccc 143 >gnl|UG|Rn.32001 EST232262 Rattus norvegicus cDNA, 3' end /clone=ROVCW01 /clone_end=3' /gb=AI235700 /gi=3829206 /len=490 Length = 490 Score = 188 bits (95), Expect = 8e-48 Identities = 107/111 (96%), Positives = 107/111 (96%) Query: 4 gatctcattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacct 63 |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 67 gatctctttacagatggttgtgagccaccatgtggttgctgggaattgaactcaggacct 126 Query: 64 ctggaagagcagtcggtgctcttaaccactgagccatctctccagccccag 114 |||||||||||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 127 ctggaagagcagtcagtgctcttaaccactgagccatccctccagccccag 177 Score = 44.1 bits (22), Expect = 3e-04 Identities = 28/30 (93%), Positives = 28/30 (93%) Query: 82 ctcttaaccactgagccatctctccagccc 111 |||||||||||||||||||| ||| ||||| Sbjct: 187 ctcttaaccactgagccatcgctctagccc 216 Score = 52.0 bits (26), Expect = 1e-06 Identities = 29/30 (96%), Positives = 29/30 (96%) Query: 82 ctcttaaccactgagccatctctccagccc 111 |||||||||||||||||||| ||||||||| Sbjct: 228 ctcttaaccactgagccatcgctccagccc 257 Score = 32.2 bits (16), Expect = 1.1 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 82 ctcttaaccactgagc 97 |||||||||||||||| Sbjct: 269 ctcttaaccactgagc 284 >gnl|UG|Rn.33246 EST208614 Rattus norvegicus cDNA, 3' end /clone=RSPBZ76 /clone_end=3' /gb=AI013939 /gi=3227995 /len=475 Length = 475 Score = 184 bits (93), Expect = 1e-46 Identities = 105/109 (96%), Positives = 105/109 (96%) Query: 4 gatctcattacagatggttgtgagccaccatgtggttgctgggatttgaactcaggacct 63 |||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| Sbjct: 75 gatcccattacagatggttgtgagccaccatgtggttgctgggaattgaactcaagacct 134 Query: 64 ctggaagagcagtcggtgctcttaaccactgagccatctctccagcccc 112 ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 135 ctggaagagcagtcggtgctcttaacctctgagccatctctccagcccc 183 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4775 Number of Sequences: 23003 Number of extensions: 4775 Number of successful extensions: 2048 Number of sequences better than 10: 546 length of query: 382 length of database: 15818664 effective HSP length: 16 effective length of query: 366 effective length of database: 15450616 effective search space: 5654925456 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)