BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 908d05 (373 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.1247 Rat cytochrome P450 mRNA, complete cds /cds=(22,... 115 1e-25 gnl|UG|Rn.32167 UI-R-A0-bg-g-05-0-UI.s1 Rattus norvegicus cDNA,... 72 1e-12 gnl|UG|Rn.16477 UI-R-A0-ai-g-10-0-UI.s1 Rattus norvegicus cDNA,... 72 1e-12 gnl|UG|Rn.27759 UI-R-BT0-po-f-11-0-UI.s1 Rattus norvegicus cDNA... 36 0.071 >gnl|UG|Rn.1247 Rat cytochrome P450 mRNA, complete cds /cds=(22,1494) /gb=M18335 /gi=203779 /len=1731 Length = 1731 Score = 115 bits (58), Expect = 1e-25 Identities = 58/58 (100%), Positives = 58/58 (100%) Query: 4 gatcccttgtgtcattgtgtatccattcctgagttaaaataaagcttcactataaaat 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1674 gatcccttgtgtcattgtgtatccattcctgagttaaaataaagcttcactataaaat 1731 >gnl|UG|Rn.32167 UI-R-A0-bg-g-05-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-A0-bg-g-05-0-UI /clone_end=3' /gb=AA866240 /gi=2961686 /len=308 Length = 308 Score = 71.9 bits (36), Expect = 1e-12 Identities = 42/44 (95%), Positives = 42/44 (95%) Query: 4 gatcccttgtgtcattgtgtatccattcctgagttaaaataaag 47 ||||||||||||||||||||| ||||||||| |||||||||||| Sbjct: 70 gatcccttgtgtcattgtgtacccattcctgggttaaaataaag 27 >gnl|UG|Rn.16477 UI-R-A0-ai-g-10-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-A0-ai-g-10-0-UI /clone_end=3' /gb=AA818198 /gi=2888078 /len=431 Length = 431 Score = 71.9 bits (36), Expect = 1e-12 Identities = 54/60 (90%), Positives = 54/60 (90%) Query: 4 gatcccttgtgtcattgtgtatccattcctgagttaaaataaagcttcactataaaataa 63 ||||||| ||||||||| |||||||||| |||| |||| ||||| ||||||||||||||| Sbjct: 70 gatccctggtgtcattgagtatccattcttgagataaattaaagattcactataaaataa 11 >gnl|UG|Rn.27759 UI-R-BT0-po-f-11-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-BT0-po-f-11-0-UI /clone_end=3' /gb=AI144987 /gi=3666786 /len=494 Length = 494 Score = 36.2 bits (18), Expect = 0.071 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 332 tgtgtttatattgacaca 349 |||||||||||||||||| Sbjct: 168 tgtgtttatattgacaca 151 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2779 Number of Sequences: 23003 Number of extensions: 2779 Number of successful extensions: 795 Number of sequences better than 10: 30 length of query: 373 length of database: 15818664 effective HSP length: 16 effective length of query: 357 effective length of database: 15450616 effective search space: 5515869912 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)