BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 881f03 (347 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.34196 EST230411 Rattus norvegicus cDNA, 3' end /clone... 210 2e-54 gnl|UG|Rn.17656 EST205475 Rattus norvegicus cDNA, 3' end /clone... 125 9e-29 gnl|UG|Rn.27982 EST214692 Rattus norvegicus cDNA, 3' end /clone... 92 1e-18 gnl|UG|Rn.28944 EST219453 Rattus norvegicus cDNA, 3' end /clone... 74 3e-13 gnl|UG|Rn.3573 EST188967 Rattus norvegicus cDNA, 3' end /clone=... 58 2e-08 >gnl|UG|Rn.34196 EST230411 Rattus norvegicus cDNA, 3' end /clone=RKIDJ33 /clone_end=3' /gb=AI233723 /gi=3817603 /len=546 Length = 546 Score = 210 bits (106), Expect = 2e-54 Identities = 167/186 (89%), Positives = 167/186 (89%), Gaps = 1/186 (0%) Query: 4 gatcaaatggggagggtcccagcccattgtggatggtgccgtccctgggctggtggtcct 63 |||||| ||||||||| |||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 228 gatcaagtggggaggg-cccagcacattgtgggtggtgccgtccctgggctggtggtcct 170 Query: 64 gggttctataaaagagcaagctgagcaagccagaggaagcaagccagtaagtaatgtcct 123 ||||||||||| || |||||||||||||||||| |||||||||||||||||| ||| Sbjct: 169 gggttctataagagggcaagctgagcaagccaggggaagcaagccagtaagtgtcatccc 110 Query: 124 tttatggcctgtgcatcagctcctgcttcctgacctgctagagttccagttctgacttcc 183 | ||||||| ||||||| ||||||||| |||||||||| |||||||||| ||||||||| Sbjct: 109 tccatggcctctgcatcaactcctgctttctgacctgcttgagttccagtcctgacttcc 50 Query: 184 tttggt 189 |||||| Sbjct: 49 tttggt 44 >gnl|UG|Rn.17656 EST205475 Rattus norvegicus cDNA, 3' end /clone=RMUAW56 /clone_end=3' /gb=AI011024 /gi=3224856 /len=452 Length = 452 Score = 125 bits (63), Expect = 9e-29 Identities = 114/131 (87%), Positives = 114/131 (87%) Query: 21 cccagcccattgtggatggtgccgtccctgggctggtggtcctgggttctataaaagagc 80 ||||||||| ||||| |||| |||||||||||||||||| || ||||||||| ||||| Sbjct: 207 cccagcccactgtgggtggtttggtccctgggctggtggtcttgagttctataagagagc 148 Query: 81 aagctgagcaagccagaggaagcaagccagtaagtaatgtccttttatggcctgtgcatc 140 ||||||||||||||| ||||||||||||||||| || ||| | ||||||| |||||| Sbjct: 147 cagctgagcaagccaggggaagcaagccagtaagaaacatccctccatggcctctgcatc 88 Query: 141 agctcctgctt 151 ||||||||||| Sbjct: 87 agctcctgctt 77 Score = 50.1 bits (25), Expect = 4e-06 Identities = 31/33 (93%), Positives = 31/33 (93%) Query: 157 cctgctagagttccagttctgacttcctttggt 189 |||||| |||||||||| ||||||||||||||| Sbjct: 83 cctgcttgagttccagtcctgacttcctttggt 51 >gnl|UG|Rn.27982 EST214692 Rattus norvegicus cDNA, 3' end /clone=RKIBJ83 /clone_end=3' /gb=AI105403 /gi=3705198 /len=535 Length = 535 Score = 91.7 bits (46), Expect = 1e-18 Identities = 82/94 (87%), Positives = 82/94 (87%) Query: 21 cccagcccattgtggatggtgccgtccctgggctggtggtcctgggttctataaaagagc 80 ||||| |||||||| |||||| |||||||| ||||||||||||||||||| | | ||| Sbjct: 221 cccaggccattgtgagcggtgccatccctgggttggtggtcctgggttctattagaaagc 162 Query: 81 aagctgagcaagccagaggaagcaagccagtaag 114 ||||||||||||||| |||||| |||||||||| Sbjct: 161 aagctgagcaagccatgggaagccagccagtaag 128 >gnl|UG|Rn.28944 EST219453 Rattus norvegicus cDNA, 3' end /clone=ROVBG68 /clone_end=3' /gb=AI175882 /gi=3726520 /len=412 Length = 412 Score = 73.8 bits (37), Expect = 3e-13 Identities = 80/92 (86%), Positives = 80/92 (86%), Gaps = 3/92 (3%) Query: 24 agcccattgtggatggtgccgtccctgggctggtggtcctgggttctataaaagagcaag 83 |||||| ||||| |||||| ||||| |||||| ||||||||||||||||| | |||| | Sbjct: 152 agcccactgtgggtggtgcaatccctcggctgggggtcctgggttctataagaaagcagg 211 Query: 84 ctgagcaagcca-gaggaagcaagccagtaag 114 |||||||||||| ||| |||||||||||||| Sbjct: 212 ctgagcaagccatgag--agcaagccagtaag 241 >gnl|UG|Rn.3573 EST188967 Rattus norvegicus cDNA, 3' end /clone=RHEAB41 /clone_end=3' /gb=AA799470 /gi=2862425 /len=659 Length = 659 Score = 58.0 bits (29), Expect = 2e-08 Identities = 65/76 (85%), Positives = 65/76 (85%), Gaps = 2/76 (2%) Query: 21 cccagcccattgtggatggtgccgtccctgggctggtggtcctgggttctataaaagagc 80 ||||||||||||||| || | || ||||||||||||| ||| ||| |||||| || ||| Sbjct: 188 cccagcccattgtgggtgttaccatccctgggctggtagtcatggcttctat--aacagc 131 Query: 81 aagctgagcaagccag 96 ||| |||||||||||| Sbjct: 130 aagttgagcaagccag 115 Score = 44.1 bits (22), Expect = 3e-04 Identities = 25/26 (96%), Positives = 25/26 (96%) Query: 135 tgcatcagctcctgcttcctgacctg 160 ||||||||||||||||||||| |||| Sbjct: 90 tgcatcagctcctgcttcctgccctg 65 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2995 Number of Sequences: 23003 Number of extensions: 2995 Number of successful extensions: 906 Number of sequences better than 10: 47 length of query: 347 length of database: 15818664 effective HSP length: 16 effective length of query: 331 effective length of database: 15450616 effective search space: 5114153896 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)