BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 846f07 (390 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.2642 Rat peptidylarginine deiminase mRNA /cds=(60,205... 64 3e-10 gnl|UG|Rn.18727 UI-R-C0-jm-g-11-0-UI.s1 Rattus norvegicus cDNA,... 48 2e-05 gnl|UG|Rn.33880 EST218698 Rattus norvegicus cDNA, 3' end /clone... 46 8e-05 gnl|UG|Rn.19759 UI-R-C2-mq-d-11-0-UI.s1 Rattus norvegicus cDNA,... 46 8e-05 gnl|UG|Rn.21444 EST194174 Rattus norvegicus cDNA, 3' end /clone... 40 0.005 >gnl|UG|Rn.2642 Rat peptidylarginine deiminase mRNA /cds=(60,2057) /gb=J05022 /gi=205959 /len=4507 Length = 4507 Score = 63.9 bits (32), Expect = 3e-10 Identities = 50/56 (89%), Positives = 50/56 (89%) Query: 292 gatggctcaggggttaaaagcacttgctgttcctgcagaggacttgggttcagttc 347 |||||| ||| |||||||||||||||||| || ||| |||||| |||||||||||| Sbjct: 3282 gatggcccagtggttaaaagcacttgctgctcttgcggaggacctgggttcagttc 3337 Score = 32.2 bits (16), Expect = 1.2 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 339 gttcagttcccaacgcccac 358 |||||||||||||| ||||| Sbjct: 3149 gttcagttcccaacacccac 3168 Score = 30.2 bits (15), Expect = 4.6 Identities = 21/23 (91%), Positives = 21/23 (91%) Query: 365 tgtaactccaggtccaggggatc 387 ||||||||||| ||||| ||||| Sbjct: 3176 tgtaactccagatccagaggatc 3198 >gnl|UG|Rn.18727 UI-R-C0-jm-g-11-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C0-jm-g-11-0-UI /clone_end=3' /gb=AI043783 /gi=3290518 /len=470 Length = 470 Score = 48.1 bits (24), Expect = 2e-05 Identities = 42/48 (87%), Positives = 42/48 (87%) Query: 303 ggttaaaagcacttgctgttcctgcagaggacttgggttcagttccca 350 |||||||||| || ||||||| |||||||||| ||||||||||||| Sbjct: 184 ggttaaaagcgctagctgttcttgcagaggacccaggttcagttccca 137 >gnl|UG|Rn.33880 EST218698 Rattus norvegicus cDNA, 3' end /clone=RMUCD62 /clone_end=3' /gb=AI175172 /gi=3725810 /len=421 Length = 421 Score = 46.1 bits (23), Expect = 8e-05 Identities = 50/59 (84%), Positives = 50/59 (84%) Query: 292 gatggctcaggggttaaaagcacttgctgttcctgcagaggacttgggttcagttccca 350 |||||||||| |||||| |||||| ||| |||| |||||| | || |||||||||||| Sbjct: 166 gatggctcagtggttaagagcactgactgctcctccagaggtcctgagttcagttccca 108 >gnl|UG|Rn.19759 UI-R-C2-mq-d-11-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C2-mq-d-11-0-UI /clone_end=3' /gb=AI070448 /gi=3396699 /len=297 Length = 297 Score = 46.1 bits (23), Expect = 8e-05 Identities = 38/43 (88%), Positives = 38/43 (88%) Query: 304 gttaaaagcacttgctgttcctgcagaggacttgggttcagtt 346 ||||| |||| |||||| || |||||||||| ||||||||||| Sbjct: 207 gttaagagcatttgctgctcttgcagaggacctgggttcagtt 165 >gnl|UG|Rn.21444 EST194174 Rattus norvegicus cDNA, 3' end /clone=RPLAG21 /clone_end=3' /gb=AA851406 /gi=2938946 /len=499 Length = 499 Score = 40.1 bits (20), Expect = 0.005 Identities = 49/59 (83%), Positives = 49/59 (83%) Query: 292 gatggctcaggggttaaaagcacttgctgttcctgcagaggacttgggttcagttccca 350 |||||||||| | |||| |||||| ||| || | |||||| |||| |||||||||||| Sbjct: 418 gatggctcagtgnttaagagcactgactgctcttccagaggtcttgagttcagttccca 360 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3803 Number of Sequences: 23003 Number of extensions: 3803 Number of successful extensions: 1137 Number of sequences better than 10: 92 length of query: 390 length of database: 15818664 effective HSP length: 16 effective length of query: 374 effective length of database: 15450616 effective search space: 5778530384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)