BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 822c04 (392 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.29011 EST220194 Rattus norvegicus cDNA, 3' end /clone... 60 5e-09 gnl|UG|Rn.17656 EST205475 Rattus norvegicus cDNA, 3' end /clone... 44 3e-04 gnl|UG|Rn.27982 EST214692 Rattus norvegicus cDNA, 3' end /clone... 44 3e-04 gnl|UG|Rn.33527 UI-R-Y0-lz-a-01-0-UI.s1 Rattus norvegicus cDNA,... 40 0.005 gnl|UG|Rn.34196 EST230411 Rattus norvegicus cDNA, 3' end /clone... 40 0.005 >gnl|UG|Rn.29011 EST220194 Rattus norvegicus cDNA, 3' end /clone=ROVBU44 /clone_end=3' /gb=AI176605 /gi=3727243 /len=638 Length = 638 Score = 60.0 bits (30), Expect = 5e-09 Identities = 49/54 (90%), Positives = 49/54 (90%), Gaps = 1/54 (1%) Query: 5 atcactaattgagaaaatgccttacaggtgaatctcttgcaagcatttcctcaa 58 ||||||||||||||||||||||||||| || ||||| || | |||||||||||| Sbjct: 182 atcactaattgagaaaatgccttacagctg-atctcatggaggcatttcctcaa 234 >gnl|UG|Rn.17656 EST205475 Rattus norvegicus cDNA, 3' end /clone=RMUAW56 /clone_end=3' /gb=AI011024 /gi=3224856 /len=452 Length = 452 Score = 44.1 bits (22), Expect = 3e-04 Identities = 25/26 (96%), Positives = 25/26 (96%) Query: 6 tcactaattgagaaaatgccttacag 31 ||||||| |||||||||||||||||| Sbjct: 222 tcactaactgagaaaatgccttacag 247 >gnl|UG|Rn.27982 EST214692 Rattus norvegicus cDNA, 3' end /clone=RKIBJ83 /clone_end=3' /gb=AI105403 /gi=3705198 /len=535 Length = 535 Score = 44.1 bits (22), Expect = 3e-04 Identities = 41/46 (89%), Positives = 41/46 (89%), Gaps = 1/46 (2%) Query: 47 gcatttcctcaactgaa-cttcttcccttctgatgactgcaacttg 91 |||||||||||||||| || ||||| ||||||||||| ||||||| Sbjct: 267 gcatttcctcaactgaggctccttcctttctgatgactccaacttg 312 >gnl|UG|Rn.33527 UI-R-Y0-lz-a-01-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-Y0-lz-a-01-0-UI /clone_end=3' /gb=AI111420 /gi=3511462 /len=289 Length = 289 Score = 40.1 bits (20), Expect = 0.005 Identities = 47/56 (83%), Positives = 47/56 (83%) Query: 7 cactaattgagaaaatgccttacaggtgaatctcttgcaagcatttcctcaactga 62 ||||| ||||||||||||||| ||| ||| |||| || | |||| ||| ||||||| Sbjct: 225 cactagttgagaaaatgccttccagctgagtctcatgaaggcatatccacaactga 170 >gnl|UG|Rn.34196 EST230411 Rattus norvegicus cDNA, 3' end /clone=RKIDJ33 /clone_end=3' /gb=AI233723 /gi=3817603 /len=546 Length = 546 Score = 40.1 bits (20), Expect = 0.005 Identities = 26/28 (92%), Positives = 26/28 (92%) Query: 4 gatcactaattgagaaaatgccttacag 31 |||||||| ||||||||||||| ||||| Sbjct: 225 gatcactagttgagaaaatgccctacag 252 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3673 Number of Sequences: 23003 Number of extensions: 3673 Number of successful extensions: 1094 Number of sequences better than 10: 42 length of query: 392 length of database: 15818664 effective HSP length: 16 effective length of query: 376 effective length of database: 15450616 effective search space: 5809431616 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)